Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig40
Contig Information
Length 632 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5f10    rwhva5f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0456100 [Oryza sativa (japonica cultivar-group)] >gi|113645070|dbj|BAF28211.1| Os11g0456100 [Oryza sativa (japonica cultivar-group)]
Score 403
Evalue 1.13723e-37
Total Hit Count 89
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig40
GTGGAAACGGTGCCTTCCTCGAAACCACGGTCTGTCGTTGATCCTCATGACTTGAAGGGTTACATGATGGGCTTTGACCCAAAGACCTTGGAGTTGTGCG
CGAAGCTGCGCACAAACGAGGCTTGTAATCTCATTGAGAAGCACAGCTGGGCACTCTTTGGAGAAAAGATGGGCTCCACGGAGATTGACGAGGCGGTGAT
ACTTGATCCGGCATCCCTTAAAAGGCTGCTGCTTGAAGCCATTGCATTTGGTTCCTTCCTTTGGGATACTGAAGACTATGTTGATGAGATATACAAGTTG
CAGGACAGCTGAAAATGGATCTCCAGAAGATTCGTGAAGCACTGGAGATACGGAGCTCGCTGGAAGAAGAGTTTGCAGAAGATTCCTGGGACCTTGTATA
TACTTTAGGAAAATACCCTTTTCTTCTGTGCATGTAAATCTTGACCTTGCAGGTGCTAAATTATTTAGTAGCTTTTTTTTTTCTGAAATAAGAACCTTGC
AGGCACTAAAAGAATAATCTACTTATGACCTTGTTGTATAGATGGTGCCAGTAAGCATATGTCCATTTAGGCATTCGCTTGCATTCTGTAATCTGTAATA
CAGTGTAGTGATGCACTCATGCATCTTCAGAT
page-top