Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig37
Contig Information
Length 956 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5d04    rwhva5d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027113 [Oryza sativa (japonica cultivar-group)]
Score 468
Evalue 1.24501e-66
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig37
ACGAGGCCCCTGAATCCAAGGTGGCGGTCTTGAATCCCATGGGCATTCCATGCGTAAAAAATACGAGGCCTCAGTCAAGTCAAAGGAGATGGCTGAATCA
AGATCAAGGGATATTAAAATGAAGATGGAGTCTATGCTGACAGACTTGCAGAGGGAGAGGCGTGCAAGTAGTTCAGCCTTAGCCATGGCTCAAAGGGCTC
GAAGGGAGAACGTCGCCATTAAAAAGGGCAATCCAAACTATAGGGTGCACTGTTAATTTCTCGACGAACGAAAATCAAGTGGACAAGTCCGAGGAGATGT
CATATTCATTTCGAAGAGAAGCTGACACTGTATCCCAGCAAGATGATAATGCTGACCTGTCTGTATCCATCTCTGCGATTGAGGACAGTTTGGTATCAGA
GACACCAAGCAACCAAGTTTGCGAATCGCTCTGCCCCTTCCGCAGCAGAGAGGGGTGCAGATGGCCACATGCTGCTTGTGCGCAGCTAGGAAGCCAGTTT
GTTGGTTTAAAGGCAAATTTTGATGCTTTTGACCGGCTATCTGTAAAAGATTGCTATTTTCCTAAAGAATAGGTGAGACCATGAGCTCAAGGCCGTTCTA
GGTGCACTTTGACAGCTGCCGGTAGATTTTTTTTCCCCGCGGTGGCGCCTCTCAGTTTGCATTGACAGCAGAAGATATGCGCTGGGAGCAAATGAAGATT
TAATTATTTTGAGTTGAAGCTCACGTCTGACTCGCAAGTTCCTCAGAAGATATGCGCTGGGCAGTTGTCATTCTAGATTAGGGGTTAGCGATTCGTTAAG
ACCCACTGGGGACTGAAAGGGCAGTCCTTTGTGTTGTATATAGTTTAAGTAATGCCAGATGTGAGAGGTGGTTTTTCCACCTTTTGTTTTCGTTAAAAAA
AAATCATCTGATTGCTTGGGAATAAGAGCTAATGTACATCCTGCTCTGAGAAAAAA
page-top