Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig36
Contig Information
Length 823 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6a04    rwhva6a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0358100 [Oryza sativa (japonica cultivar-group)] >gi|11544696|emb|CAC17628.1| putative phospholipid hydroperoxide glutathione peroxidase [Oryza sativa (japonica cultivar-group)] >gi|108708259|gb|ABF96054.1| glutathione peroxidase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548616|dbj|BAF12059.1| Os03g0358100 [Oryza sativa (japonica cultivar-group)] >gi|125543925|gb|EAY90064.1| hypothetical protein OsI_11636 [Oryza sativa Indica Group] >gi|125586318|gb|EAZ26982.1| hypothetical protein OsJ_010465 [Oryza sativa (japonica cultivar-group)]
Score 824
Evalue 2.95595e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig36
CGAGGGAGGTTCGGGAGGACTTACGCCGTCCGGGAGGCGAAGAGAGGGCGAGATGGGGGCGTCCGAATCTGTGCCGGAGACCTCCGTGCACGAATTCACC
GTTAAGGATTGCAACGGCAAGGAGGTGTGCCTGGACACGTACAAGGGGAAGGTCCTCCTCATCGTCAACGTCGCCTCCAAATGCGGGTTCACGGAGACTA
ATTACACGCAACTGACGGAGCTTTATCAGAAGTACAGGGAGAAAGACTTTGAGATATTAGCATTCCCCTGCAACCAGTTTTTGCGACAAGAGCCAGGCAG
TGACCAGCAGATCCAAGACTTTGCATGCACAAGATTCAAAGCTGAATATCCAGTTTTTCAGAAGGTGCGTGTAAATGGCCCAGATGCTGCGCCGCTTTAT
AAGTTTTTGAAAGCTAGCAAACCTGGTTTGTTTGGTTCAAGAATCAAGTGGAACTTTACCAAGTTTCTTGTTGACAAGAATGGGAAAGTAATCAACAGAT
ACGCAACTGCTACCACTCCATTTTCATTCGAGAAAGACATCCAGAAGGCACTTGAGGAGGAACCCTCCGAGTCGCAGACAAAAAAGGAGGAGGAATCTTC
TGACTCGCAGAAGTAGGCACTTGCAAAGTATCCCCGTTGTAATATCTAGACCAATCTCTGCCAGTAAATTAATGTGATATTTCCCCTGGTTTGATCATTG
TTCTTGTATTTGTGACTTCCTCTTATGTAAGTAGAGGTTGTGTAGCTATCAATTATTTATCTGTTTTGGGTGCTTTTGTCGAGGTACACGAGCTATTGAT
GAACTGGAATCGTATGCAGTTTA
page-top