Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig30
Contig Information
Length 555 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5p10    rwhva5p10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0866600 [Oryza sativa (japonica cultivar-group)] >gi|56785200|dbj|BAD81918.1| BolA-like protein [Oryza sativa Japonica Group] >gi|113534439|dbj|BAF06822.1| Os01g0866600 [Oryza sativa (japonica cultivar-group)] >gi|125528496|gb|EAY76610.1| hypothetical protein OsI_04560 [Oryza sativa Indica Group] >gi|125572760|gb|EAZ14275.1| hypothetical protein OsJ_004100 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 1.604e-33
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig30
GAGGGCCTTGGCAGAACAGACAGAGAGACCGAGAAGAGAGGGCGAAGAGGGGAGCAGGAGGAGGCAATCGCGAACAGACCAACCATGGGCGTGACCAAGG
AGGACGTGGAGGCCGCCGTCGCCGCCGCGCTCAGCCCTACCCACCTCGTGGTCACCGATACATCCGGCGGGTGCGGCGCGAGCTACGAGATCGAGGTGGT
GTCGGACAAGTTCGAGGGGAAGCGGCTGCTGGAGCGCCACCGGATGGTCAACACCGCGCTGGCGCCGCTCATGGCCGAGATCCACGCCGTCTCCATCAAG
GCGCTCACCCCCGCGCAGGCCCAGCCCAAGTCGGAGCCGGCCGCCGCCGACAAGGCGCAGGCCTGACTCGCTCTTTAGGATTCACTAGTACTGAATTCAC
ACATGCGCCGCTGGATGTCGGGAGCTCGCATCATACAGTACTCTCTGCTTGAATGAATAATGTAGCAACTAGCAAGATGCGTCTGCGGAATCGAGACTTT
GCAGTGGCGCTATGCCTGGCTGATAAGACTTTGCTGCATTTTGTCAAAAAAAAAA
page-top