Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig28
Contig Information
Length 557 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5g21    rwhva5g21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Agropyron cristatum]
Score 505
Evalue 1.22245e-49
Total Hit Count 413
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig28
AGCAACCGAGCGAACGGCGGCGACGACCCGAAGAGGGAGAAGAAGATGGTGATGCCCACGGACCCGATGCTATGGCACAAGGTGGCCGCCGTCTCCGGGG
TCGCTGCTCTTGGACTGGGCACCTATGGAGCGCACATGTTCCGCCCCCAGAACCCTAGATACAAAGAGATTTGGCAGACCGCGTCCCTGTACCATCTCGT
CCACACCGCGGCGCTGCTCGGGGCTCCCATGACCAAGCGCCCCAACATCTTCGGAGGCCTTCTGACAACTGGAATTGTGCTCTTCTCTGGAACGTGCTAC
ACTGTGGCTTACCTTGAAGACAGGAAGTTCTCTTCACCAGCACCGATCGGTGGCTTTGCATTCATTGCTGCTTGGGCCAGCCTGCTCTTCTGATTGTATT
GTGTTTTATCGGGTGAAAACTATGTCTACCTTACACAAGGCTTTGTATCAGTTGCTCTATTAGGTCATGATTGCACTGCTGTGGCACACATCTTTCTCGT
GGCCTTTATAGATAATAATTGAAATAAAACAGTTCCCTTGATGTTTCAAAAAAAAAA
page-top