Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig27
Contig Information
Length 1022 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6a18    rwhva6a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peptide transporter PTR2 [Zea mays]
Score 912
Evalue 1.2634e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig27
TGGCTTTCGGTGCCTGGAGAAATCGGTGGTAGAGACCGGAGAGACAGGGCCATGGTCGCTGTGCACCGTGACCCAGGTGGAGGAGACCAAGATCGTCCTC
CGGATGGTGCCCATCTTCCTCAGCTCCGTCCTCGGATACATCCCGGTGCCGCTCATCCTCAACTTCACCGTGCAGCAGGGGAACACCATGGACACCAAGC
TCGGCGGCGTCCACATCTCCCCGGCCACGCTCTTCGTCATCCCCACCGTCTTCCAGATGGTGATCCTCGTCCTCTACGACCGGTTCATCGTCCCCTTCCT
GCGCAGGATCACCGGATACGTGGGCGGCGTCACGCATCTGCAGCGCATCGGGATCGGGTTCCTCTCGGCCACCGTGGCCACCGGCGTCGCCGCCCTGGTG
GAGGCCAAGAGGAAGAGGGTCGCGGAGGAGAACGGCCTCATGGAAGCCACCACCGGGATCCCCATGTCCGTCTTCTGGCTGACGGTGCAGTTCTTCCTCC
TCGGGGTGGTGGACGTCACCTCCTTCGTGGGGCTCCTCGAGTTCTTCTACAGCGAGGCGTCCACGGGGATGAAGTCCGTCGGCAGCTCCATCTTCTACTG
CATCCTCGGGGTGTCCGGCTTGGCTGGGGAGCCTGCTCATCCAGGTGGCCAACCGGGTCACCAGGCGCGCCGACGGGACGGGAGGCTGGCTGGACGGCAC
CAACTTGAACATGGGCAAGCTCGACAACTTCTACTGGCTGCTTGCTGTGCTTGAGCTGGTGTCGCTCTTCGTCTACACCTTCTTCGCCAGGAGGTATGTG
TATAGGAATGAGCAAAGGGTTGTGGATGTGGACACCAAGGTTCCAATGGAAGGTGCCACCTTTGGTGATGTGATGATCTAGACTAGACTAGATGATGATA
CACGACCAAACTAGACAATGCCAACTTCAATTGTGACGTACAAGTACCAACTACCACTCAGTGTTTTGACTGGACCAATGTGGATGGGCCGGGATGTTAT
ATGACTCTTTTTGAGCGTTCAC
page-top