Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig26
Contig Information
Length 747 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6a16    rwhva6a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold-responsive LEA/RAB-related COR protein [Triticum aestivum]
Score 523
Evalue 7.22654e-53
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig26
AGGAAAGAACACCACAAATTAGTACGTACCAACACTCCATCAACTTCAAAAATGTCTGGTTGGTTTCAAGAGAAGTCCGGGNGACGCCACCAAGACGGCG
TCCGAGACGGGGCAGACCATTCAAGACCGCGCCGTCGAGGCAAAAGACCAGACCGGGGCCTTCCTTGGTGAGAAAAGCGAGGCTGTCACGAAGGCTGCCT
CCGAGACTACCGAGGCGGCTAAAAAGATGGGCGGCGAGGCCATGGGGAAGGCGTCCGAGACGGTGGAAGCCGGTAAGGATCACGCCGTCGAGGGCAAAGA
CCAGACAGGCAGCTTTTTCGGCGACAAGACTGACGCTGTCAAGAAGACGGCCACCGAGACTGCCGATGCCACCAAGGAGAAGTCCACCGAGGCCGCCCAG
CATGTCCAGGACACCGCTGCACAGTACACCAAGGATACCCCGGTCGCCCCCAAGGAAAACGTCTTCCAGCAGGCCGGCGGGAATATGGTGGGTGCCGCTA
CAGACGCCAAGGACGCTGTCATGAACACGCTCGGGATGGGAGGAGACAAGTGAGATGCGGGTGGTGCCACCAAGAAGACCACAAAGGATAATAGGCGCGT
CTGCGCTTGCTTGCCCTAGCCCTCCTTCTGTTTCGCTATTCCTTCAATATAATTTAATTTCCAGTTCCATGGCACTAATTTACACATGCTCCTTGGTGTA
ACTTTGTATGATGTATCCGACCGAGGTATGAATATATTTCCACCAAT
page-top