Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig24
Contig Information
Length 899 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5h03    rwhva5h03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit actin 3 [Torenia fournieri]
Score 810
Evalue 1.44642e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig24
CGGGAAATCGTCAGGGACAATCAAGGAGAAGCTCGCCTACGTCGCCCTCGACTACGAGCAGGAGCTGGAGACCGCCAGGACCAGCTCCTCCGTCGAGAAG
AACTACGAGCTGCCGGACGGCCAGGTGATCACCATCGGCGCGGAGCGGTTCAGGTGCCCCGAGGTGCTCTTCCAGCCGTCCATGATCGGCATGGAGGCCG
CCGGCATCCACGAGGCCACGTACAACTCCATCATGAAGTGCGATGTCGATATCAGGAAGGATCTGTACGGCAATGTCGTGCTCAGTGGGGGTTCCACCAT
GTTCCCTGGGATCGCCGACCGTATGAACAAGGAGATCACCGCACTCGCGCCCAGCAGCATGAGGGTGAAGGTGGTCGCCCCGCCGGAGAGGAAGTACAGT
GTGTGGATCGGCGGCTCCATTCTTGCCTCTCTCAGTACCTTCCAGCAGATGTGGATCTCCAAGGCGGAGTACGATGAAACCGGCCCGTCGATCGTCCACA
TGAAGTGCTTCTGATCAGTCCGTGGCTGACCAACCTGTACCTGTCATTCAGTTGCTTGAGGTCCAAACCGCAGATGCCTGAATGTGTCATGGTTTCCACG
GCGTCGTGGTTCACTGAATCATGGAACAAGTTTGAAAGGTAAGGTCGATTGATGGTTTCGAACAATTCCGTAGGGCGTCGGGTCAGTTTCAGTGGGTTCA
CTGAAGGTGGGTTGGGACATTTATTTTGGTTTCGGCGATTCAGCACATGCGTGTGCTGGAGACCTGAAACAGAGTGTCGTTTGTTTGCACCACCCCGGCG
AGGGTGTTGATTCTTGTACCTTTTGTAGCGGGGGTTTCTTGTCGAACTACCTGGTCTGTTCTTGTTTGTAGAAGGAAGCTTATTGGTACTTAAGCATTG
page-top