Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig22
Contig Information
Length 691 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5h06    rwhva5h06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os11g39040 [Oryza sativa (japonica cultivar-group)] >gi|125577652|gb|EAZ18874.1| hypothetical protein OsJ_033083 [Oryza sativa (japonica cultivar-group)]
Score 120
Evalue 9.14254e-05
Total Hit Count 81
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig22
TTCTTCTCCCGCCCCCTCCCAAATCCCCACTTTGCGCCGGCGAATCTTCTTGGCGATGGCTGGTAAGCAGGGCCGCAAGAAGGCGAGGAGTCCCCCCGGA
TGCCCTCAGCTGCGTCCGATCGGCAGCACCGTCTCCGGATCGAAGAAGCCTGCGGCGGCGACGGTTCCTTCGTGCAAGTACCACCTGTCGGAGGCGTCTG
TCCAGGCGGTCCTAAACCACAAGAGGGTGCCTTTCGTCCTTGGGGACTACTTCGACGACCTGACCCCCGAGGAGCAGCAACTCACGCTCGAGGTGGCCGC
CCAGCACGAGGAGGTCGAGGACAGGTACGCCAAGTACCAGGAAAGAGTCCGCAAGGAGCTGGATGAGAAGGGATTCGTCGCGCTCCCCGATGACGTTGAC
AAGAGGAGGGCCGCGCTGAACGCCGCAAGCATCGAGGCTTTCAGAGGAGTCGCCGAGGTCAAGTAGGTTTTCAGGAATTTACATAGAAGAAGAGGATGCA
TCATAGCGCCGTCTGCCTCTCTTGTTTTATCTATCTATATATCTTTCTGTGTGATATCAATGCACTGGTCTAGATTTCCTAAATCTGTTCGCTGGCACTC
TTTCATTTATCAAGCTGGGAACTAGTCATTGTGATCTAAGTTGATCTATGTTTCACCTTGCAATAAACTTGTCTATAAATTAAAAAAAAAA
page-top