Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig21
Contig Information
Length 774 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5o07    rwhva1p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Photosystem I reaction center subunit XI, chloroplastic; Short=PSI-L; AltName: Full=PSI subunit V; Flags: Precursor >gi|167087|gb|AAA62700.1| photosystem I hydrophobic protein
Score 985
Evalue 5.64185e-105
Total Hit Count 131
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig21
ATGGCCACATGCATATGCTCCTCCGATGGCGAGCCAGGTGATGAAGAGCGGCTTGGTGTGCTCCAAGCCGCGGGGCATGTCCGGCGCTTCGCTCACCAGG
AGGCCCCGCCTCGTCGTCAAGGCCGTCAAGTCTGACAAGCCGACGTACCAGGTGGTCCAGCCCATCAACGGCGACCCATTCATCGGCAGCCTGGAGACGC
CCGTCACCTCCAGCCCCCTCGTCGCCTGGTACCTCTCAAACCTCCCCGCCTACCGCACCGCCGTCAGCCCGCTCCTCCGCGGCATCGAGGTCGGCCTCGC
CCACGGCTACCTCCTGGTCGGCCCCTTCGCGCTCACCGGCCCGCTCCGCAACACGCCAATTCACGGCCAGGCAGGCACTCTCGGCGCCATCGGCCTCGTC
TCCATCCTTAGCGTCTGCCTCACCATGTACGGTGTCGCGTCCTTCAACGAGGGCGCACCGTCAACCGCGCCCGCACTCACGCTCACAGGCCGCAAGAAGG
AGGCCGACAAGCTGCAGACCGCTGAAGGGTGGTCGCAGTTCACCGGAGGCTTCTTCTTCGGTGGTGTCTCCGGTGCCACCTGGGCCTACTTCCTCCTTTA
CGTGCTCGACCTCCCATACTTCTTCAAGTAGATTAATTATTGGCATGCATGTACGATGGGTGCAGATCATGTGATCTCTTCCCGATGGTGGTTGCTTCAA
AGAGTCCATGTATAAATGAATTTACACATTCCTCACAATCTTTGCATGGATCGATCATACTACGATACTATAAC
page-top