Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig20
Contig Information
Length 1239 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5o04    rwhva5o04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0136800 [Oryza sativa (japonica cultivar-group)] >gi|55296987|dbj|BAD68462.1| putative ATP-dependent Clp protease proteolytic subunit [Oryza sativa Japonica Group] >gi|113594769|dbj|BAF18643.1| Os06g0136800 [Oryza sativa (japonica cultivar-group)] >gi|215692474|dbj|BAG87894.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704676|dbj|BAG94304.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737501|dbj|BAG96631.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197521|gb|EEC79948.1| hypothetical protein OsI_21540 [Oryza sativa Indica Group]
Score 1399
Evalue 1.19522e-152
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig20
GGCTGGCTTGCTGCTTCCGATAATCGACAGTTCTCTAGTCTTTCTCCCTCTGTTCCCCCGAGCCACTCCGCAGCCCTGCTCCAATGGCGCTGTGCCGGAC
GGCGCCCGCCAACTCCTCCTGCTTCCACCCCCGCGCCGTCGCCAGCTCGCCCTCCTCTCTCAGCGTCGGCACCAAGGTCTTCGTCGGGTTGAAGGCCCAG
ACCAGGCTCGGCTCGTCCGAGTCGTCGTGCCCGAATGTCAACGCCCGGTTCTACACCGCCGTCAACCGGAGGGTCTCCCTGGGGTTGTCAAACAAAAGGG
CTACCAGGGCACGTATTTCAATGATGCCTGTCGGCACACCACGGGTACCTTACAGAACACCTGGTGAAGGAACCTGGCAGTGGCTTGACATATGGAATGC
TTTATATCGTGAACGGATTATCTTCATCGGGGACACTATTGATGAAGAATTCAGTAACCAAGTACTGGCAAGCATGCTGTATCTTGACAGTGTCGATGAC
ACAAAAAAGATTCTTCTATACATCAATGGTCCAGGAGGAGATCTTACACCATGCATGGCGTTATATGATACCATGCTAAGCCTAAAGAGTCCAATTGGTA
CTCATTGCCTGGGCTTTGCATTCAACTTGGCAGGATTCATTATTGCAGCTGGTCAAAAGGGTTCACGTACGGGTATGCCTCTTTGCCGTGTTTCACTTCA
GTCACCTGCTGGAGCAGCTCGAGGCCAGGCTGATGATATAGAAAATGAATCAAACGAACTTAATCGGATCAAGAACTATCTTTATGGCAAGCTAGCAGAA
CACACGGGCCATTCTGTTGAAAAGGTTCATGAGGACCTATCGAGGTCGAAGCGCTTTGACGCCGAAGGAGCCCTCGAATACGGGATCATCGACCGTATCG
TCAGGCCTTCCCGGATCAAGAAAGAGGGCGGCTCGACCACCGGTCAGAAGAAGGAGCTGCGGAATCTGGGACTCGGCTAATCTTTAGATGTCAGCGCACC
AGAGTTAGCCGTAGACCGCCACAGTTTTTCCACGTCTAGTCCTGCTTCGAAATCTCGACGCTTCCTTTCATCGGTTCATGCGGATGTACGAGATTTAGCT
TGTCTCTCCGGTATCCCCAGACTTTTAAGACAGAGCGATAGCACACTGAGAAACGCCGCGCACGTTTGATGATTTCGCGCGACATTAATGTTCTTGTTGA
GTCAGTGGTCCGGCAAGACGCTGTCTGATACCTAGTTTT
page-top