Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig17
Contig Information
Length 1073 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5o10    rwhva5o10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195609644|gb|ACG26652.1| GTP-binding protein SAR1A [Zea mays] >gi|195653011|gb|ACG45973.1| GTP-binding protein SAR1A [Zea mays]
Score 859
Evalue 3.99187e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig17
GGCCTCGTGCCGCCAGCGAGGGGGAGAAAGAGAGAGAGAGAGAGGGAGGGAGGTCGAGGCGAGCGTCGACCGGTCGTTCGGTGTGAGGAGGAAGAGGAAG
AGATCGCCGGAGAAGAGGAGGCGGACGAGAAGAGATGTTTCTGGTGGATTGGTTCTACGGGGTGCTGGCGTCGCTGGGGCTGTGGCAGAAGGAGGCCAAG
ATCCTCTTCCTCGGCCTGGACAACGCCGGCAAGACCACCCTCCTCCACATGCTCAAGGACGAGCGGCTGGTGCAGCACCAGCCGACGCAGTACCCGACGT
CCGAGGAGCTGAGCATCGGCCAGATCAAGTTCAAGACCTTCGATCTCGGTGGCCACCAGATCGCCCGCCGAGTCTGGAAGGACTACTACGCCAAGGTGGA
TGCGGTTGTTTACTTGGTGGACGCTGCTGACAAGGAACGGTTTGCCGAGTCGAAGAAGGAGCTCGACGGCCTTCTTTCAGATGACTCCCTTGCGAATGTG
CCTTTCCTCGTACTGGGTAACAAGATCGACATACCTATCGCAGCATCCGAGGAGGAGCTGCGCTACTACCTTGGGCTGAGCAACTTCACCACTGGGAAGG
GCAACGTGAACTTGTCGGATTCAAATGTGCGGCCCCTGGAGGTGTTCATGTGCAGCATCGTCCGCAAGATGGGCTATGGTGAAGGTTTCAAATGGATGTC
CCAGTACATCAAGTGAAGGGCCTTCCTGCTGTCCACCGTGGCAATATTCAGGTCCTGGTTCTTTGCCCGTCTCATCATCCTTGATGCTCTGGGGAGAACT
GCAGCTGCAAGAAAAGATTTATCTTAGTGATAGGGAAAACCTGTAAGTTGACGATAATCCTAGATATATGGTTGCGTAAATTTGTTTGACAGTTCGTGTG
TAATGTGATTTTACTAGTTACAATGCGGTTGCTGGGATCAGTTGTAGACTATGGGAAGTGTCTCAGCTATTGTAATCTGTCATCTCAGTCGGTGAAATGT
TTGTTACCACCAGCTTAGATTATGTTGGTGAAACTTTTTGAGCAACCCTGTCCATCGAGAAGTGCGCTGAGCC
page-top