Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig15
Contig Information
Length 885 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5n11    rwhva5n11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CHLREDRAFT_192533 [Chlamydomonas reinhardtii] >gi|158274747|gb|EDP00528.1| predicted protein [Chlamydomonas reinhardtii]
Score 92
Evalue 0.253389
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig15
ACGAGGCTTCCCTGTAGCTCCTCCTCTGCTTTCTCCTCGAACCCGTAGCAGCAGCGGAGCAGGAGCCCTCGCACCCGAGCCTCACCGACCCTGCAGGCTG
TGCCCTCCGGCGACCCCGCCGCCGGCGATCAGGGCGAGGACCGGCCTTCTCCTGCTCCTCTCCTCCCTGTCTCTTTTCCTGCCCGTGCTTCTCTCTCACA
GCTCCCTCTCACAGGAACGATGCCATGGCCTCCCTTTTCCCCCGACTCCTTCACCTCTCTCTCCTCTTCAGGAACTCCACGATGCCGCCGCAGACCTTGC
CATGGAGCCGCTGGATGCCGCCCTTTGCAGCACCGTTGCCAAGACCGTGGGCCACCGCGTTCGGAGATGGTCGGACCTGCCCCAGCCCGACAGCTTGTGC
CTCTCCGCGTCCTCCCCATCCTGCCGCTGCCGCGTCCGGCATCCTCGTCTTCGCGCCGCCGCCTCTGTTGTTCCGCTCGACTGCTGCCTAAAGTCGCTGG
AACACCGACGCCCCGAACTAGCATCATGGAGACGCCACCATCGCCTCCTCCACCGGATCTCCTTCACTCCGCCACCCAGCCGCCGGATCTGCCCGTTCCG
GACGGTTCCCGCCCGGCGCCGCGTCGAACCCATGCCTCCTCCGCTGCAGTTCTTCTTCAGCGAGATGCAGCAGCGCTGCATCGAGCGCTTGACCACCACA
CACGTGGGTCACCAGCTGGGCTCCAGATCAGGCCCAACGCGCCTCCTCCCCACCGACTTGGGCTTGGCCCATGGTGAGGGCACCCCGCGCCCCTCCTTTT
TTCCCCTCCTGTTGGGCTAGGCTGCCAGTTTGGGCCTGTATAGTTTTTTTAGGCTGTGTGAATTTCTGTAATATTCTAGNAAAAC
page-top