Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig14
Contig Information
Length 852 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5i20    rwhva5i20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19541 [Oryza sativa Indica Group]
Score 876
Evalue 2.93646e-92
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig14
AAGCCATTGAGTTCTCTAATGCTGGTGCTTGGATGATGATGACAAACAAATGTGAGAGATTTCTACATAGACGCTCAAGCTATAGAGAGCTTCAGTATAT
TTCTGATGGTGATAACAATGGTGTGATCTACTATGCTGGGACGTCATTCGGGAAGCATCAATGGATCAATCCTGTTTTAGCCAAGAATATCACTGTGACG
GCAAGCAGCCCAAATTCGAGGTACACGGATCCAAAGGCTCTGGTTTCAAAAAATTACCAGGGGACTTGTTTTGCTGGGCCTCGAGACGAAGATGGCAAGA
AGTGTTCTTGGTGGATGGTAGACATTGGACAGGACCACCAGCTTATGTGCAACTACTACACGGTAAGGCAGGATGGCTCTACGGCATTTATGAGGTCTTG
GATTCTTCAGGGATCCATGGATGGTGAGAACTGGACAAGCCTCATTGTTAACGAGGACGAGCGGGCCATCTGCCAGCCAGGGCAGTTTGCGTCGTGGCCG
ATCACAGGCCCGGCGGCGCTGCTGCCATTCCGGTTCTTCCGGCTTGCTCTGACGGGGCCGACGACCAGTTAACACCTGGGAACCCTCTGCATCTGCTTCC
TGGAGCTCTACGGCTACTTCCGCTAGACGGAGACAGGTCTCGTGTAAGATGTTTTCTGTTGTTTTAAAGATTAGAACTGCACCAGATGTGACAAAGAAGG
ACAACACTGTATGTATCACTGTTTACACACAGCACAAACACCTCTTGCTTGAGTTACACACACACACACTGGTACAAGCATGTGGTACATAGAGTTCATA
AAAGGATACTTGTAATAAGCTGGAATAAATGTTTCCGCAAAAAGAAAGTGGA
page-top