Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig13
Contig Information
Length 688 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5j07    rwhva5j07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 211
Evalue 2.51328e-15
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig13
ATATATACAATCTTATCAGGCTTTTAGCTACGGCTGTCATGGCTTTCGCTAATGGTCTCAAGTTAGCTGCCCTGTGTGTGTTGGTCCTGACTGTGGGCCA
ACTGATGGCAGTTGCTGATGCGTCGGCTCCACTCATGCAGTCTGTAGAGCAGGAGCGCTCAACCTTCGAGGATTGCCCCTGCAGCCCAGATAAATTGTGG
TGTTGCCTCCGAGCAAGCGGAGTCGCAAAACCCTTCAAGGATTGCCCCTGCAGCCCTGATAAATTGTGGTGTTGCCTTAAAGCAAGCAGAGTCGCAAAAC
CCTCCGAGGATTGCCTCTGCAGTCCTCGTACCAGGTTTTGTTGCCTTCAAGCAAGCGAAATCCCAAAAGCCTCCGAGAATTGAACTAAAATCTTCAGGAG
GGGGCCAGACGGTAAGAGATGAACATTAAGACGTACGTATGGCTTGAACTTGAAGCATCATTTTCTTTGAGTTCCATCCATGTCTACATCTTTTATGTGT
ATTGTATGTGGTCGCATGTCATGCGGTGTGTCTAACTAAAGAATAAATATGTAAGCTCCAAGGAAGATAATCGTCTTGGAGATGCATATGCGATGTGCAT
ATGCCAGTTTATTGTTGGGGTTGGTGTTGTAGCAATTATATGTTGTTTTCAAGTGTTTATCTATCTTGCTCTCAATAAATAAATAAGT
page-top