Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig12
Contig Information
Length 1254 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5j08    rwhva5j08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023948 [Oryza sativa (japonica cultivar-group)]
Score 1198
Evalue 2.4485e-129
Total Hit Count 92
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig12
GCCGTCGGACGCCATCCCTAGCCACCGCCACGCTCCGGCCAACCGAGCCGTTCCCTCTCCCGAGCGGTCTATCCCTTGCGCGGCGCCTGAAGCTGCTCCT
CTCCTTCTCCCGCGCCGACCTCTCCGTGAGCCCCGTCGACGAGTGGCAGCTCAAGTCCGCGCTCCTCGCCTTCCTCCGCAACCCGCCGCTCTCGCTCTCC
CTCCTCCAAGACTCCGACCTGTCCGTCAGCCGCCTCCCGGACCTGCAGAAGCGCCGTCGGGACGATCCCGTCGCCTCCGGCATCCTGTACGTCCGCGATC
TCTCCTTCCTCCGCCCAGGCAACCGCACAGGAGACAACGAAGCCGAGAAGATGACCCCAGAGCAGGAGGAGAAGAAGTACTCACAGTGGCGGAGCTCCCT
GGTCGAGAAGCTAGATGGCATCGACCTCAACCTTAAGGGGGTTATGTACCGGATGAGTGTCGAGATCCCCGCCTCAGATGACTTCACGGCGATGAAGAAG
TCATGGGAGGATTTTTACGCCTCCGAGCTCTTTAGTACTAGGAATCCGGTGAGGAAGATAGCAAAAAGACCAGACACAATTCTTGTGAGAGGTGTGCCGT
CCAGGTGGTTTGCGGAGACGAGGATATCGTCGAAGGCGTCCACATTGGTCACCCACACTATCTTCTCAGCTCTTGGTAAAATAAGGACCTTAAATATTTC
TAATGACGATGAATTAGAAGAAAAAAAAGATGAGACTAATAAGGGTCTCATATCTGGACTCAATTGTAAGGTGTGGGTGCAATTTGAGAGTTATGATGAC
TTCCACAATGCAATGAAGGCATTATGTGGGCGGTCATTAGAGAAGGAAGGATCGCGGTTGAAAGTGAACTATGATGTGACTTGGGACAGGGAAGGTTTCT
TTCGTAATGCACAATGCGAGCCTGCACATAACAAACTAGAAGAAACAGATGCACCGGTACATGGAAGGAAGAAACATTACACCTCGCGGATCGAATCAGA
TCATAGGAAGAGATTCAGGGATTGATGGCGCAAAGGATATGATGAGTTGTGAAATTACATGTCATAAGGAGGAGAATTGGTTGTATTCTGTGGTCTGTAT
CATTGTGATGTTCACTATTCGTTTTTTGTCTCCTTTTACTTCTCGTCATTAGTCTAACAGTAAAATCATTCCGTCCGAGTCGCTGATTTGTACTCCCTCC
GTCCCACAGTATAAGCTATTACAGCTATTGTGGTGGCACCTAGTGATACCGAAA
page-top