Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig10
Contig Information
Length 728 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva19a04   
Homology (BLAST) Top Hit hypothetical protein OsI_38270 [Oryza sativa Indica Group]
Score 798
Evalue 2.43089e-83
Total Hit Count 408
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig10
AGACCTCTTCCCTTCTCCCCACCAGGNAGTCTAGGGGTTAGAGAGAAAGAGTGAGAGAAGAGCAAAAACAACCTCTAGCCCCACTGTTGATTTAATTTGC
CAGCAGGCTTGTTGTCAACTTCATATCTATCCCATTTCCCTTCAATATCTTCATATCACAATGGGTGGCCTATCCATGGAGCACCCTTGGGCATTCGCCT
TCGGCCTACTAGGCAACGTGATCTCTTTCTCGAGCCTCCTGGCCCCGATACCAACATTCTACCGGATCTTCAAGAGCAAATCCACGGAGGGGTTCCAGTC
GGTGCCCTACGTCGTGGCCCTGTTCAGCGCGATGCTGTGGATCTTCTACGCACTGGTCAAGACCGGTGAGGGCCTCCTCATCAGCATCAACGCTGCCGGC
TGCGTCATCGAGACCGTCTACATCGTCATGTACCTCGTCTACGCCCCCAGGAAGGCCAAGATTTTCACAGCCAAGATCGTCGTCCTCCTCAACATCGCCG
GCTTCGGGCTCATCTTCCTCCTCACCCTCTTCGCCTTCCATGGCGAGACACGCGTCGTCACACTCGGCTGGATCTGCGTCGGCTTCTCCGTCTGCGTCTT
CGTTGCCCCACTCAGCATCATCGGACGAGTCATCAAGACCAAGAGTGTGGAGTACATGCCCTTCACGCTCTCCCTGACGCTCACCCTCAGCGCAATCGTC
TGGTTCCTCTACGGCCTGCTCATCAAGG
page-top