Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig7
Contig Information
Length 736 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva4i22   
Homology (BLAST) Top Hit CBL-interacting protein kinase [Hordeum brevisubulatum]
Score 767
Evalue 9.81754e-80
Total Hit Count 347
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig7
TGGATCTGTTCTGAAGAACCATGCTTTCAATAAATCTTCATCAAAAGATGATAACTGAAGTTTACACAGACATCACTAGGGGAATGGAAACGAATAACAA
ACTTACGATAATAACAATTACAGAAACACACGGACGCCTGGTAATTGCCTCAAGTTGTAAAATGAATGTAGCACTTGGCACAGTTCTTCTCAACATGGTT
GCTGCTGCGGCTGCGGCTGCTGCTCGCCTTGCCACGCCCAGACTATGTCCTTCAGCGCCGGCCTCATCTCCTGGTTCAAGACCTTCTGGTACTCCAGAGT
ATCACCGTTTGTCTTCTTCAACTCGACGAGATGGAAGTCAGGGGTGACCTCGAATATCTCAGCATCAATGGACATCACACCTTTCCTTCCAGCCTTGAAG
CTTTCCATCCTCAACATGCCACCATCTTTCTTGACGAGCTTCAGTCGCATGCACTTTGCGATGTCCTCGATCTTTGACACGATCGTCGAAGCCGAGTTGG
TGGATGTGAACTTGGACTCCCTCTTCTTGTCATTGTCCTCAAACATACCAGAGAGGTCGAGTCCGGTTGAGAGGGAGATTATATCGAAAGCATTCAAGTT
GGCGAGCTTTTTTGCTTCTTGTTCCTTGCCCTCTGTTGCTGAGTTGCTGCAGCTCAAGGAATCAGAAGTCGCAGTCATGTCAGCAGCANGAACGGCATCT
TTTGCTTGCAAATTGTATCTGAGCAGTTTTGCATCT
page-top