Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig6
Contig Information
Length 354 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva2b06   
Homology (BLAST) Top Hit hypothetical protein OsI_12198 [Oryza sativa Indica Group]
Score 244
Evalue 1.52672e-19
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig6
CGAGGCCTCGTGCCGGCCCCCACTACCGCCTCCTCTAAGCCGATCATGAGGAGAGAAGACCTGCTGAAGCTGCCTGCCGAGGTGAGGCAAGACGACGACC
TCGCTGCGGCTGCTGCGGAGGCCGCCAATGGACGCCCGGTTTACTGCAGGGATCGCTACTACCGGGCGCTCGCCGGCGGTCAGTACTGCACCTCAGACGA
CCTGCTCAACTGATGATAGCAAATAGTAATAGTACATACGTATTCTGGTATATGCAGTTTGCCACATTTATATAATAAGCACAAGTTAAGCAAATGTATC
TTATCGGAATGAAATTTTGGGAAGAACGATGTTGTTGATTCTGTAAAAAAAAAA
page-top