Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig3
Contig Information
Length 690 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva13j23   
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 563
Evalue 6.18753e-79
Total Hit Count 161
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig3
TCATATCTTTATATATTAACAAAACATGCCCAGCAATCGCTTGGATGCGATGCGGTACTTAGGTACAAAGGATAAAACATCAGATATTAAATTGGCATGC
TTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTCGCCGTTGGGTCGAAGTTCTTGGCAGTCTGGTCGGTGCATCCTGCCGGTACAGGCAAAGTACCT
TGCTGTGCCCCTTTACCTCCTCCTATGCAGCAAGAGATGGTGGGTGTGTATGGAGAATGTTCTAACCGTAGAAGGTACCAGTCTTCATCGCATCCTGGTT
AGCATCACCCAGAGCTGCCTGGCTCATGTAGGTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCCTGGACGAGCATGTGCCCGTACTCTAGCAGC
TTCTCCACTGTCATCTTTGGCTGCTCAAAGGTCACTGGTCCGTCCCGCGAGTTCACCAGCTTCTTGCCAATGTTCTCGATACCCTTGCAGACACCGATAC
GGTCGTCGCGGGTGGGAGCCCAGTANAACTTCTCCATACGACCATCACGGATCANAGGGGCGTACAACGTCNAGAAATCGTTACCAGTGACGACGATGGG
CACACGTGGGTTCTCCTCCTTGTTGTACATGCCTGGGGAGCTGCACATTGGTGGGGGCATCGGCGATGTTCATGAGGGTGGCGTTCACCA
page-top