Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig1
Contig Information
Length 750 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva3o24   
Homology (BLAST) Top Hit putative brown planthopper susceptibility protein Hd002A [Oryza sativa (indica cultivar-group)]
Score 450
Evalue 6.91162e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig1
CGAGGTTTTGCTCATGGAAACATTTTTCATGCGCAGATACCAGATACGGTACATAACAGAGCAGAAGCTTCCGGGCATGCTTCTTTACAAGGAAAAGCTC
TCCTAAAAGTTCCCAGGCTTATTTTTGCGATACAGGCTACAACACTTTTACAGACTATAGATCTGCCTGCTACTCAAAAGTACCGCGGACACACATATTT
ACAAAATCCACAAGTACCGGGCATGGACTCCTGCATCTCTAAAACTTCAGCATGGCCTCCAACGCGCGAAGAACGTCATCGCGGGTAACTATACCTATTA
CTTGATTGTCCTGGTTTACTATCGGTAATCTGTGGATCTTCTTCTTGAGCATCAGAGCTGCGGCATCGGTCACTGTTTTATCGCAAGATAGCGTGATTGC
TGGAGATGTCATCACATCTGCAATCAACGTCTTTGACCCATGTGAAGCCCTCACGCGATCGCTCTTGACGATGACCCCGACGCATCTGCGAGCGCTGTCG
ACAACCGGGAGGCCTGACACGAGCTGATCGGCAGCGTGGGAAGGCGACTGCTGTTGCTGCTGCTGCTGGGACTGGAGGTACGCGCGGAGGTCGTCGTAGC
TGAGAAGGGAGAAGTTCTCGGGCCACTCCCCGGAGATGATGGGCGTCGGGGTTCTCGTCGAGCCCGAGCCGGAGCCCGCTTCCATCCATGAATGTGGACG
CCCGGCACCCGAAGCTCCCGCCGCCGCTGGCTCTGCCCCTCCTGGNCTCA
page-top