Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1708
Contig Information
Length 1137 bp
Tissue Shoot grown under cold condition for 3days
Clones 213 Clones [Download: CSV  ,  FASTA ]
whv3n1e22    whv3n1f01    whv3n2g15    whv3n2m18    whv3n3h10    whv3n3h21    whv3n3j05    whv3n3j13    whv3n4c03    whv3n4e01    whv3n4i06    whv3n4k08    whv3n4o07    whv3n5a18    whv3n5e20    whv3n5f20    whv3n5i04    whv3n5j24    whv3n5n19    whv3n6a04    whv3n6c04    whv3n6c05    whv3n6m15    whv3n7c10    whv3n7d14    whv3n7f18    whv3n7k01    whv3n7p15    whv3n8c15    whv3n8c24    whv3n8g19    whv3n8i02    whv3n8i13    whv3n8p05    whv3n9f07    whv3n9m04    whv3n9n14    whv3n9n17    whv3n10b13    whv3n10c01    whv3n10d09    whv3n10h12    whv3n10o20    whv3n11b15    whv3n11b22    whv3n11d21    whv3n11e03    whv3n11e06    whv3n11e17    whv3n11g22    whv3n11i23    whv3n11k03    whv3n11n17    whv3n11o08    whv3n11p16    whv3n12c03    whv3n12d01    whv3n12d08    whv3n12f02    whv3n13b03    whv3n13b19    whv3n13c22    whv3n13e13    whv3n13e19    whv3n13f15    whv3n13k09    whv3n13k22    whv3n13l01    whv3n13l09    whv3n13m03    whv3n13m06    whv3n13o08    whv3n14e01    whv3n14i16    whv3n14j19    whv3n14j20    whv3n14l10    whv3n14m05    whv3n15b05    whv3n15e02    whv3n15e09    whv3n15g18    whv3n15h03    whv3n15h13    whv3n15m12    whv3n15m23    whv3n16b11    whv3n16e09    whv3n16g05    whv3n17b04    whv3n17d15    whv3n17h02    whv3n17j06    whv3n17k23    whv3n18a18    whv3n18c03    whv3n18e22    whv3n18j05    whv3n18n04    whv3n19f15    whv3n19k23    whv3n19o02    whv3n19o04    whv3n20b17    whv3n20b23    whv3n20g16    whv3n20j05    whv3n20k12    whv3n20l23    whv3n20o11    whv3n20p19    rwhv3n1a08    rwhv3n1e22    rwhv3n2g15    rwhv3n2h09    rwhv3n2m18    rwhv3n3h10    rwhv3n3h21    rwhv3n3j05    rwhv3n3j13    rwhv3n4c03    rwhv3n4e01    rwhv3n4i06    rwhv3n4o07    rwhv3n5a18    rwhv3n5j24    rwhv3n5n19    rwhv3n6a04    rwhv3n6c04    rwhv3n6c05    rwhv3n7d14    rwhv3n7f18    rwhv3n7k01    rwhv3n7p15    rwhv3n8c15    rwhv3n8c24    rwhv3n8g19    rwhv3n8i02    rwhv3n8i13    rwhv3n8p05    rwhv3n9f07    rwhv3n9f24    rwhv3n9j02    rwhv3n9m04    rwhv3n9m15    rwhv3n9n14    rwhv3n9n17    rwhv3n10b13    rwhv3n10c01    rwhv3n10d09    rwhv3n10h12    rwhv3n10o20    rwhv3n11b15    rwhv3n11d21    rwhv3n11e03    rwhv3n11e06    rwhv3n11g22    rwhv3n11i23    rwhv3n11k03    rwhv3n11n17    rwhv3n11o08    rwhv3n11p16    rwhv3n12c03    rwhv3n12d01    rwhv3n12d08    rwhv3n12f02    rwhv3n12i08    rwhv3n13b03    rwhv3n13b19    rwhv3n13c22    rwhv3n13e13    rwhv3n13e19    rwhv3n13f15    rwhv3n13k09    rwhv3n13k22    rwhv3n13l09    rwhv3n13m03    rwhv3n13m06    rwhv3n13o08    rwhv3n14e01    rwhv3n14j19    rwhv3n14j20    rwhv3n14l10    rwhv3n14m05    rwhv3n15b05    rwhv3n15e02    rwhv3n15g18    rwhv3n15h03    rwhv3n15h13    rwhv3n15m12    rwhv3n15m23    rwhv3n16b11    rwhv3n16e09    rwhv3n16g05    rwhv3n17a18    rwhv3n17c03    rwhv3n17e22    rwhv3n17j05    rwhv3n18b04    rwhv3n18d15    rwhv3n18h02    rwhv3n18j06    rwhv3n18k23    rwhv3n19f15    rwhv3n19o04    rwhv3n20b17    rwhv3n20b23    rwhv3n20g16    rwhv3n20j05    rwhv3n20k12    rwhv3n20l23    rwhv3n20o11    rwhv3n20p19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 780
Evalue 4.01298e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1708
GTCGGAAGCAGAGTCGTGGACAAAAGTGAAGTTCACAAATGACCATCATACATAGGCCATTGTTTCAACTTGTAGTTTAGGCCTTGCCCTCCTCCTAGCA
AGCTATATACCTACATAGTACAGCCATGGCCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGGCTCAAGTCCACCGCCGGCCT
CCCCGCTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCCATTGAGGGCATCAAGAA
GTTCGAGACCCTGTCCTACTTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCTTGCCTCGAGTTC
AGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCCCCTGGGTACTATGATGGCCGGTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCG
ACGCCACACAAGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAGTG
CGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTGCAGTTT
TGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTACCAACATGGCTC
GAGAAAGCATGCTCGTATGAGAATGCTATGCGGTGGCTATGTATATGAACGGACGCATAATATTATACAATATGTCGACTATATACGTTTTAATGGTAAC
CAATGGAAAATATCTCCACCACCGTGCTTATTACTTCCTCTGTAAATTAATATAGAGCGTTTCGATCACTGCTTTAGTGATCTAAACGCTCTTATGTTAG
TTTACAGAGGGGATACTTTTTATTAATAGTGGACGGTTGGACGTTGTCTTAGTTTGTATCCCTGAAATGTATGGTTGTAAACATGGCCCCACAGAATGTT
GGCCAACAATATAATATTAGTTGTATTAAAAAAAAAA
page-top