Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1707
Contig Information
Length 836 bp
Tissue Shoot grown under cold condition for 3days
Clones 170 Clones [Download: CSV  ,  FASTA ]
whv3n1a01    whv3n1c20    whv3n1d11    whv3n1g05    whv3n1h19    whv3n1n23    whv3n1o03    whv3n2m10    whv3n2n08    whv3n3b22    whv3n3c24    whv3n3e23    whv3n3g17    whv3n3j11    whv3n3n02    whv3n4b21    whv3n4j18    whv3n4k22    whv3n4m22    whv3n4p14    whv3n5m22    whv3n5o01    whv3n6b12    whv3n6i14    whv3n7g07    whv3n7i21    whv3n7o02    whv3n8a20    whv3n8b11    whv3n8b19    whv3n8f02    whv3n8k19    whv3n9b04    whv3n9c21    whv3n9g14    whv3n10b18    whv3n10g20    whv3n10n09    whv3n10p05    whv3n11j16    whv3n11l06    whv3n11m02    whv3n12g17    whv3n12k06    whv3n12k16    whv3n13a22    whv3n13g02    whv3n13g17    whv3n13j20    whv3n13m14    whv3n13n08    whv3n13n11    whv3n13n21    whv3n14a02    whv3n14a18    whv3n14d03    whv3n14e22    whv3n14j05    whv3n14j13    whv3n14p09    whv3n15a01    whv3n15a02    whv3n15a03    whv3n15g22    whv3n15h14    whv3n15k22    whv3n15l11    whv3n15l23    whv3n16b05    whv3n16g04    whv3n16g17    whv3n16i05    whv3n16j09    whv3n17b17    whv3n17m05    whv3n17p18    whv3n18e13    whv3n18n05    whv3n18p09    whv3n19e13    whv3n19g09    whv3n20c02    whv3n20i14    whv3n20i19    whv3n20j11    whv3n20p12    rwhv3n1a01    rwhv3n1c20    rwhv3n1d11    rwhv3n1g05    rwhv3n1h19    rwhv3n1n23    rwhv3n1o03    rwhv3n2m10    rwhv3n2n08    rwhv3n3b22    rwhv3n3c24    rwhv3n3e23    rwhv3n3e24    rwhv3n3g17    rwhv3n3j11    rwhv3n3n02    rwhv3n4j18    rwhv3n4k22    rwhv3n4m22    rwhv3n4p14    rwhv3n5m22    rwhv3n5o01    rwhv3n5o12    rwhv3n6b12    rwhv3n6i14    rwhv3n7d03    rwhv3n7g07    rwhv3n7i21    rwhv3n7o02    rwhv3n8a20    rwhv3n8b11    rwhv3n8b19    rwhv3n8f02    rwhv3n8k19    rwhv3n9b04    rwhv3n9c21    rwhv3n9g14    rwhv3n10b18    rwhv3n10g20    rwhv3n10k07    rwhv3n10n09    rwhv3n10p05    rwhv3n11j16    rwhv3n11l06    rwhv3n11m02    rwhv3n12g17    rwhv3n12k06    rwhv3n12k16    rwhv3n13a22    rwhv3n13g02    rwhv3n13g17    rwhv3n13j20    rwhv3n13m14    rwhv3n13n08    rwhv3n14a02    rwhv3n14a18    rwhv3n14d03    rwhv3n14e22    rwhv3n14j05    rwhv3n14j13    rwhv3n14p09    rwhv3n15a01    rwhv3n15a03    rwhv3n15g22    rwhv3n15h14    rwhv3n15k22    rwhv3n15l11    rwhv3n15l23    rwhv3n16b05    rwhv3n16g04    rwhv3n16g17    rwhv3n16i05    rwhv3n16j09    rwhv3n17e13    rwhv3n17n05    rwhv3n17p09    rwhv3n18b17    rwhv3n18m05    rwhv3n18p18    rwhv3n19e13    rwhv3n19g09    rwhv3n20c02    rwhv3n20i14    rwhv3n20i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 923
Evalue 1.00726e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1707
CAGAGTGCCTCCTCCTAGCAAGCTATATACCTACATAGTACAGCCATGGGCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGG
CTCAAGTCCACCGCCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGC
CCATCGAGGGCATCAAGAAGTTCGAGACCCTGTCCTACTTGCCACCGCTCAGCACGGAGGCCCTCCTTAAGCAGGTCGACTACCTGATCCGCTCCAAGTG
GGTGCCTTGCCTCGAGTTCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCCCCTGGGTACTACGATGGCCGGTACTGGACAATGTGGAAGCTG
CCTATGTTCGGATGCACCGACGCCACGCAGGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGATTCGACA
ACATGCGTCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATA
TAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGT
TCATGTACGAACATGGCTCGAGAAAGCATGCTCGTATGTGAATGCTATCGGTGGCTATGTATATGCACGGACGCATAATATTATACAATATGTCGACTAT
ATACGTTTTTAATGGTAACCAATGGAAAATAAAAAA
page-top