Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1700
Contig Information
Length 1783 bp
Tissue Shoot grown under cold condition for 3days
Clones 65 Clones [Download: CSV  ,  FASTA ]
whv3n1c07    whv3n1n10    whv3n2g04    whv3n2k13    whv3n3d16    whv3n3h20    whv3n3l01    whv3n3o23    whv3n3p09    whv3n4h10    whv3n4m12    whv3n4p05    whv3n5f04    whv3n5o02    whv3n8e02    whv3n8g10    whv3n9e03    whv3n9e04    whv3n11i05    whv3n11n13    whv3n12f01    whv3n13d14    whv3n13g16    whv3n13p16    whv3n14a12    whv3n15b01    whv3n15k17    whv3n15k19    whv3n16o10    whv3n16o18    whv3n17k02    whv3n18h02    whv3n19g10    rwhv3n1n10    rwhv3n2g04    rwhv3n2k13    rwhv3n3d16    rwhv3n3h20    rwhv3n3l01    rwhv3n3o23    rwhv3n3p09    rwhv3n4h10    rwhv3n4l05    rwhv3n4m12    rwhv3n4p05    rwhv3n5f04    rwhv3n5o02    rwhv3n8e02    rwhv3n8g10    rwhv3n9e03    rwhv3n9e04    rwhv3n11i05    rwhv3n11n13    rwhv3n12f01    rwhv3n13d14    rwhv3n13p16    rwhv3n14a12    rwhv3n15b01    rwhv3n15k19    rwhv3n16c13    rwhv3n16o10    rwhv3n16o18    rwhv3n18k02    rwhv3n19g10    rwhv3n20m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum aestivum] >gi|132065|sp|P11383|RBL_WHEAT RecName: Full=Ribulose bisphosphate carboxylase large chain; Short=RuBisCO large subunit; Flags: Precursor >gi|344053|dbj|BAA00146.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (H-type) [Triticum aestivum] >gi|13928213|dbj|BAB47042.1| RuBisCO large subunit [Triticum aestivum] >gi|61378606|gb|AAX44940.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Australopyrum pectinatum] >gi|169666638|gb|ACA63887.1| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Triticum aestivum]
Score 1289
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1700
AACGAACCGTGTTAACTTACCATAACAACAACTCAATTCCTATCGAATTCCTATAGTGGAATTCCTATAGGATAGAACATACACAGGGTGTACGCATTAT
ATATGAATGAAACATATTCATTAACCTAAGCATGCCCTCAATTTTCTTTAATGAGTTGATATTATATTAATTGAATATCCTTTTTGTTTTACGAGATTTT
TGCTAAAGTTTCATTTACGCCTAATTAACATCGAGTAGACCCTGTTATTGTGAGAATTCTTAATTCAAGAGTTATAGGGAGGGACTTATGTCACCACAAA
CAGAAACTAAAGCAGGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAAATTGACTTACTACACCCCAGAGTATGAAACTAAGGATACTGATATCTTGGC
AGCATTCCGAGTAAGTCCTCAGCCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACT
GATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAGCCAATGGATCTGTTATGTAGCTTATCCAT
TAGACCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTTTGGAGGATCT
ACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGA
TGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTATGGTAGAGCGTGTTATGAGTGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAAA
ACGTAAACTCACAACCATTTATGCGCTGGAGAGACCGTTTTGTCTTTTGTGCCGAAGCTATTTATAAATCACAGGCCCGAAACCGGTGAAATCAAGGGGG
CATTACTTGAATGCGACTGCGGGTACATGTGAAGAAATGATTAAGAGAGCTGTATTTGCAAGAGAATTAGGGGTTCCTATTGTAATGCATGACTACTTAA
CTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGCGACAATGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACA
GAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACTCCGGTACAGTAGTAGGTAAGTTAGAAGGG
GAACGCGAAATGACTTTAGGTTTTGTTGATTTATTGCGCGATGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCA
TGCCAGGTGTTATACCGGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTACAATTTGGTGG
AGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTT
GCTCGCGAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGC
CGGTAGATACTATTGATAAGTAGATAAAACTAAAGATAAAGAAGAGAAGGTATAAATAAAAAAGAAACGAAATAAAAAAAAAA
page-top