Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1698
Contig Information
Length 637 bp
Tissue Shoot grown under cold condition for 3days
Clones 42 Clones [Download: CSV  ,  FASTA ]
whv3n1e06    whv3n3c04    whv3n10g06    whv3n10g07    whv3n10k05    whv3n10m08    whv3n11k06    whv3n11m14    whv3n11n02    whv3n16e14    whv3n17o19    whv3n18e23    whv3n18e24    whv3n18h16    whv3n18l08    whv3n18l17    whv3n18o08    whv3n20f14    rwhv3n1e06    rwhv3n3c04    rwhv3n5a15    rwhv3n6g06    rwhv3n6g17    rwhv3n6m16    rwhv3n7a06    rwhv3n10g06    rwhv3n10j15    rwhv3n10k05    rwhv3n10m08    rwhv3n11k06    rwhv3n11m14    rwhv3n11n02    rwhv3n16e14    rwhv3n17e23    rwhv3n17e24    rwhv3n17f11    rwhv3n17h16    rwhv3n17l08    rwhv3n17l17    rwhv3n17o08    rwhv3n18o19    rwhv3n20f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hblt14.2 protein [Hordeum vulgare subsp. vulgare]
Score 255
Evalue 1.69053e-20
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1698
TTTTTTTTTTGATAGGGTATGTTCATTCAAGAAGACGATCACACATTCGCACTGACAAAGTATTATGTATTACGTTGATGGTACGTACATGTAGCACACA
AAGGAGCGAAAAATAGAGACATGGACTGAGAGGAAATACAGATACAGACACTCATTAAGGAACGTGGACATGAGCGAGACGCCGGTGTTTTTCTTCCCGG
CGATGTCAGCTATAGAAGTCTAAATCCCACAAGTTCAGCTTCAGCTCGTATGTATGTAGGTCAGAACATGAACTAGAGATGATCATGGGTGAGAAGGGAC
CCCAGGAATCACCACCAGCGGGCCGTTAATGGTACTGGTTCCGGTTCCCACAACCGGCAGGTCTGGCAACCCCGAACCCGAAGAAGCCTTGGACTCGGCG
ACGCCGGCACCGCGTGCCGTTGTGAGTGCCTGGTCCTTCTGGTTCAGCTCCCTCCCGTCGCAGGACGCGAGCACCACCAGCAGCAGGAGCGCAACGGCGA
CACACTTTGCCATTGCTAACTGGGAGGTTCTGAACTTTTGATACTAGTGACTAGTGAGGAGCAGTCTAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
page-top