Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1689
Contig Information
Length 1083 bp
Tissue Shoot grown under cold condition for 3days
Clones 35 Clones [Download: CSV  ,  FASTA ]
whv3n1b03    whv3n1c08    whv3n2p16    whv3n3g03    whv3n3j07    whv3n4o05    whv3n5k13    whv3n6l18    whv3n6o18    whv3n7f08    whv3n7k16    whv3n8o13    whv3n14o12    whv3n16h21    whv3n17p23    whv3n18e16    whv3n18f03    rwhv3n1c08    rwhv3n1j07    rwhv3n2p16    rwhv3n3d14    rwhv3n3g03    rwhv3n4o05    rwhv3n5k13    rwhv3n6l18    rwhv3n6o18    rwhv3n7f08    rwhv3n7k16    rwhv3n8o13    rwhv3n13i13    rwhv3n16h21    rwhv3n17e16    rwhv3n18p23    rwhv3n19k19    rwhv3n19k20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 1245
Evalue 7.0747e-135
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1689
TTTTTTTTTTAAAAGGGTAAACTGTTCATGAAAATATTATTAAACTTATATATGATGTCTTTTGATCACAGGACGATCAAATTATGCATCACATGGTAGT
ACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGGGTTCTATTGCTTATGGCGAATTCACATCGGGCCATCCCGGCATCCAGTACTGGAAAACAACGAGT
ACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGATATCTTGATATATGTACGCGTTTGCATTCGCATGTATATATAGGAGTTAACCGCTGGG
GAAGATTTACTGCTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAATGGCCGCCGACGAGCTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAAC
GGGTAGGTCAGGAGGTTCTGCAGGGACACGTTCACTGCCTCCTTTTCGAGGACGGTGCACTGGTCATCGAAAGGCATGGAGGCGCACTCAGTCTGCACCT
TCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGGAGTCGTCTGCGCCATCCTTGAGTGAGAGCAGAGCCTTGATTCCACCGCA
GCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGAGCACAGACGGCGTATTCGATGGCCGATCCAACACCGGCGTACTTGTTCTTGCAGTAGGAG
GGGACCATGTTGGCGATGTTGCGGATGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTGACCGATGGGCACACACGCGAGTCGGCGCACGCGAACACCA
TGTACTTGGGCGCCTGGCCGGCCTTGAGGGGCTCGAAGAAATCGGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTC
CACGGCGGCGTCCATCAATGCGGGTGCGACGGGCGCGGCCTGGACGGGGGTGTTCCTGATGAGCTTGGGGCGGAAGGAGGAGGAGTTGGAGGGCGCGGGG
GTGCCGAGGCTGGCGACGATGGTGGAGGAGCGGGCACGGGGCGCGACGGTTGCGTAGCACCAGTTAGCCGCGGCGGTCGACAT
page-top