Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1686
Contig Information
Length 797 bp
Tissue Shoot grown under cold condition for 3days
Clones 31 Clones [Download: CSV  ,  FASTA ]
whv3n5h23    whv3n7f07    whv3n8p13    whv3n9j14    whv3n10i01    whv3n11j20    whv3n12k07    whv3n14n18    whv3n15g21    whv3n15g23    whv3n15h22    whv3n16m14    whv3n17n01    whv3n19n03    whv3n19n04    rwhv3n1h12    rwhv3n5h23    rwhv3n8p13    rwhv3n9j14    rwhv3n10i01    rwhv3n11j20    rwhv3n12k07    rwhv3n14n18    rwhv3n15g21    rwhv3n15g23    rwhv3n15h22    rwhv3n16m14    rwhv3n18n01    rwhv3n19n03    rwhv3n19n04    rwhv3n19n15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit group3 late embryogenesis abundant protein [Triticum aestivum]
Score 561
Evalue 8.78968e-56
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1686
TCAAGTTGATTATGATTTTGTGAAAAATATATTCATACCTCGGTCGCATACATCAAACAAAGTTACACCAAGGAGTGTGTATAAATCAGTCTCTTGAAAC
TGAAATTTAATTTATATTGGGGGAATAACAAAACGAAAGGAGGGCGAGGGTAAGCAGGCGCGTCTAATTATCGTTTATGATCTTCTTGGTGCCGCTACCC
GCATCTTATTTGTCTCCTCCCATCCCGAGTGTGTTCATCACAGCATCCTTGGCACCCGTCGCGGCACCCATCATATTCCCGCCAGCCTGCTGGAAGACGT
TTTCCTTGGGGGCGACCGGGGGATCCTTGGTGTACTGTGCAGCGGTGTCTTGGACATACTGCGCGGCCTCGGTAGACTTCTCCTTGGCGGCGTCGGTGGT
CTCGGTGGCCGTCTTCTTGACAGCCTCAGTCTTCTCGCTGAGGAAGCCGCCCGTCTGGTCTTTGCCCTCGACGGCGCGATCCTTCCCGGCTTCCACTGTC
TCGGACGCCTTCCCCATGGCCTCGCCACCCATCTTTTTGGCCGCCTCAGTAGTCTCGGAGGCAGCCTTCGTGACAGCCGCGCTCTTCTCGCCAAGGAAGC
TGCCGGTCTGGTCTTTTGCCTCGACGGCACGGTCCTGGATGGATTGCCCCGTCTCGGACGCCATCTTCTTGGCCTCGCCGGCCTTAACTTGGGTCACGTC
CACCACCTCCCCGGACTTCTCTTGAAACCAGCCAGACATCTTTGAAGTCGATGGAGTACTGGTACCTACTAATTTGTGTTCTTCCCTCGTGCCGAAT
page-top