Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig5
Contig Information
Length 769 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva1a04   
Homology (BLAST) Top Hit peptidyl-prolyl cis-trans isomerase [Zea mays]
Score 904
Evalue 3.20341e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig5
CTTTGATCTTTCTATTGTCTGTTGAATTCCACAGAATGCCAAACCATAAGCACAAAAAGGGAAACAAAACAATTGTACAAGGTTAGAAATTGCAGCGCAT
GACATCGGTTTTAGTACCGTAAGACAATTGCCTGTCAAAGAACTCTTATATACAGAAACATGCTACCCTACAATCTTGTAGCTCGGGTTGACAAGATTGT
CTAGGCCTGAGACAACCTGGATTGATTCAATAACGTCCCCAACCTTGAGATCAGCCAAGAAATCCTCATTCTCGGTTACATATCCAAACACCGAATACCG
TCCGTCCAATATATTGGAATTGCTTGGCGTCAGCTCACTTTCTTTCAAGAGCCAGAAGACTTGACTAGAAGCGGAGTTGTCATCAAATTCTTCTCTAGCC
ATTGCCATCGTTCCAAATGCATTAAAAGGAAGCTTTGTTTGAGCCTTGTAAAGACCAAGTTCCTCAAGTGTTTCACCATATATAGGCGCCTTGTCACCAT
CAACCATTATCTCAAGAGGTATGGTACGACTCTTGCCAGTACTGGGATCAATAAAACCCTCGGCTGGTCCCTCGGGATCTCCCGTCTGAACAACAAAACC
ATCAGCTCTTTGGATTTCCATGCCATCATAGAACTTCCGTTCCACCAGATCTACGAAGTTCCCAGAAGTCACAGGAGCATTNNATCCATCCAGAACTATC
CGAAATACACAATCTTNCTACGTTTGGATTATCTTTAATCTTAACCGTCATATCCACAGTAGCTCTTCC
page-top