Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1683
Contig Information
Length 2604 bp
Tissue Shoot grown under cold condition for 3days
Clones 28 Clones [Download: CSV  ,  FASTA ]
whv3n1a11    whv3n2m24    whv3n4n06    whv3n6f04    whv3n6k14    whv3n7h01    whv3n7h02    whv3n8l09    whv3n8l23    whv3n11d09    whv3n15p10    whv3n17g09    whv3n17j08    whv3n18f20    whv3n18o04    whv3n19a16    whv3n19m13    rwhv3n1m24    rwhv3n4n06    rwhv3n5i04    rwhv3n6f04    rwhv3n6k14    rwhv3n7h02    rwhv3n8l09    rwhv3n8l23    rwhv3n18g09    rwhv3n19a16    rwhv3n19m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 3614
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1683
TGCCTCCCTCCTCCTCCTCCTCCCCGTTGCTCGCCGCCGTCCCCCTCCGCCTCCGCGCACCCAGGAAAGATGGCGTCCCACATTGTCGGATACCCGCGCA
TGGGCCCCAAGAGGGAGCTCAAGTTTGCCCTGGAGTCTTTCTGGGATGGCAAGAGCAGCGCCGAGGATTTGGAGAAGGTTGCCACCGACCTCAGGGCCAG
CATCTGGAAGCAGATGGCTGATGCTGGGATCAAGTACATCCCCAGCAACACCTTCTCCTACTATGATCAGGTTCTTGACACCACCGCCATGCTCGGTGCC
GTCCCAGACCGTTACTCATGGACCGGTGGGGAGATCAATTTGAGCACCTACTTCTCGATGGCTAGGGGTAACGCCACCGTCCCTGCTATGGAGATGACCA
AGTGGTTCGACACCAACTACCACTTTATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGC
TAAGGCGCTTGGCGTTGATACCGTCCCAGTACTTGTCGGACCAGTCTCATACTTGTTGCTCTCAAAGGCCGCCAAGGGTGTAGAGAAATCATTCTCTCCC
CTTTCCCTTCTTAGCAGCATCCTTCCCGTCTACAAGGAGGTTATTGCTGAGTTGAAGGCAGCTGGCGCTTCATGGATTCAGTTTGATGAGCCCACCCTTG
TTAAGGACCTTGAATCCCACCAATTGTCTGCATTCTCTGCAGCTTACGCAGAACTTGAGTCCGCACTTTCTGGATTGAACGTTCTTGTTGAGACCTACTT
CGCTGACGTTCCCGCAGACTCGTACAAGACTCTTACATCATTGAGCAGTGTAACTGCTTATGGTTTTGACCTTGAACGTGGAACCAAGACTCTTGAGCTT
GTCAAGAGTGGTTTCCCTGCTGGAAAGTACCTCTTTGCTGGTGTCGTAGATGGACGCAACATTTGGGCTGATGACCTTGCTGCATCTCTCGCCACTCTTC
AGTCTCTCGAGGCTGTTGTTGGGAAGGACAAGCTTGTCGTATCGACTTCGTGCTCACTCATGCACACTGCTGTGGACCTTGTAAATGAGACCAAGCTTGA
TGATGAGATTAAGTCATGGCTCGCATTTGCCGCCCAAAAGGTCGTTGAGGTGAACGCCCTTGCCAAGGCATTGGCTGGTCAAAAGGATGAGGCTTACTTC
GCAGCAAATGCTGCTGCTCTGGCCTCAAGAAGGTCGTCACCACGTGTCACAAATGAGGAGGTCCAGAAGGCTGCTACTGCTCTCAAGGGCTCTGATCACC
GCCGTGCTACCACCGTTAGCGCTAGGTTGGATGCGCAGCAGAAGAAGCTCAACCTTCCGGTCCTTCCCACGACCACCATTGGATCATTCCCACAGACCGT
GGAGCTCAGGAGAGTTCGCCGTGAGTACAAGGCAAAGAAGATCTCTGAGGAGGAGTACACCAACGCCATCAAGGAGGAAATTAGCAAGGTTGTTAAGATC
CAAGAAGAGCTTGACATTGATGTGCTTGTGCACGGAGAGCCAGAGAGGAACGATATGGTTGAGTACTTCGGTGAGCAGCTCTCTGGTTTCACATTCACTG
CCAATGGCTGGGTGCAATCTTATGGATCCAGGTGCGTCAAGCCACCGATTATCTATGGTGACGTGAGCCGCCCCAACCCCATGACTGTGTTCTGGTCCAA
GATGGCACAGAGCATGACTGCTCGCCCAATGAAGGGAATGTTGACAGGCCCTGTCACAATCCTTAACTGGTCTTTTGTCAGAAATGACCAACCGAGGTTT
GAGACTTGCTACCAGATTGCTCTTGCAATCAAGAAGGAGGTTGAGGATCTTGAGGCAGGCGGTATTCAGGTCATCCAAATTGACGAGGCTGCTTTGAGAG
AGGGTCTGCCACTCCGCAAGTCTGAGCACGCTTTCTACTTGGACTGGGCCGTGCACTCCTTCAGGATCACCAACTGCGGTGTCCAGGACACCACCCAGAT
CCACACCCACATGTGCTACTCCAACTTCAACGACATCATCCAGTCCATCATCAACATGGACGCTGATGTGATCACCATTGAGAACTCGCGGTCTGACGAG
AAGCTTCTCTCCGTCTTCCGCGAGGGTGTGGTGTACGGTGCAGGCATTGGCCCGGGTGTGTACGACATCCACTCCCCCAGGATCCCGTCCAAGGAGGAGA
TTGCCGACCGTGTCAACAAGATGCTCGCGGTGCTCGACACCAACATCCTGTGGGTGAACCCTGACTGCGGTCTCAAGACCCGCAAGTACGCCGAGGTCAA
GCCTGCGCTCACCAACATGGTTGAGGCCGCCAAGCAGATCCGCGCCGAGCTCGCCAAGGCGCAGTAAGCCGTGCTTGTATAGCAGCTCCCCACTTTTAAT
TGCAAGGAGGATGTCACCACCATAGCCGTGTTTACTTTTGAATAATCTGGGTCTCGTATCCACTTGTTGGTTAGGCTAGTTTGTTTCTCGGTGCGGCGCG
ATGTGCTCATCCCTTGATTTGGTGGTTTTTGAGGCGGTTGTCGGTGTGTATTGTAAACTGAGTGGCGAATTGTTCATCTAAGTCTGAGTTTGTTAAAAAA
AAAA
page-top