Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1676
Contig Information
Length 1036 bp
Tissue Shoot grown under cold condition for 3days
Clones 25 Clones [Download: CSV  ,  FASTA ]
whv3n1b19    whv3n3b03    whv3n5a03    whv3n6h17    whv3n8k01    whv3n9f05    whv3n11o23    whv3n13c05    whv3n13c06    whv3n19b23    whv3n19k08    whv3n20k01    rwhv3n1b19    rwhv3n3b03    rwhv3n5a03    rwhv3n8k01    rwhv3n9f05    rwhv3n11o23    rwhv3n13c05    rwhv3n13c06    rwhv3n14b20    rwhv3n18b01    rwhv3n19b23    rwhv3n19k08    rwhv3n20k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1333
Evalue 4.08701e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1676
CAGTTAAGCAAGAACACACAGAAGTATTTATCTGTTCTCATGAACCATCATATCACAACAAAATGGTCAGACCGATGCAAGGTGCGACATGGAAGTGGAC
AAACCGAACCGTGCTTTTGCACAAATTTCTTGTAATTTACATCATGATAGTACAACTCAGGCCACAGGAGAACATGCCTCATTGCGAGCACAGCTCCCAA
GACACCTTACTTGCCGGGGACAAAGTTGGTGGCGAATGCCCATGCATTGTTGTTGACGGGGTCGGCGATGTGGTCAGCGAGGTTCTCAAGTGGGCCCTTG
CCCGTGACGATAGCTTGGACAAAGAAGCCAAACATTGAGAACATGGCAAGGCGACCGTTCTTGATCTCCTTCACCTTGAGCTCGGCGAATGCCTCAGGGT
CTTCGGCCAAGCCAAGAGGGTCGAAGCTACCGCCTGGGTAGAGTGGGTCAACGATCTCACCGAGTGGGCCGCCGGCAACACGGTACCCCTCGACGGCACC
CATGAGCACGACCTGGCATGCCCAAATAGCTAGGATGCTTTGTGCGTGCACTAGGCTGGGGTTGCCGAGGTAGTCGAGACCACCCTCACTAAAGATCTGG
GAGCCGGCCTTGAACCAAACGGCCTCGCCAAACTTGACGCCGTTGCGGGCGAGCAACTCAGGGAAGACACAACCAAGTGCCCCAAGCATGGCCCAGCGAC
AGTGGATCACCTCCAGCTCCCGGTTCTTGGAGAAGGTCTCCGGGTCAGCCGAAAGTCCAGCAGTGTCCCACCCATAGTCGCCAGGGAACTCACCGGTCAG
GTAGCTCGGAGGCTCACCGGAGAGTGGGCCGAGGTAGAGCACACGGTCAGCACCGTACCATGGGCTGCCGGAGGAAACCTGCTTTGCCTTTGCTGCGGTC
TTGCGCATGGTGACGCGGGCCTCGCCCAAGAGAGCCAAAGATGGTACATTCTTCACCGCCTTGCCGGCAAAGGTCGAGGAGGAGAGGGACATGGTGGCTG
CCGCCATTGGAAAGCTAACAAAAGTGTCTGATGTGT
page-top