Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1675
Contig Information
Length 842 bp
Tissue Shoot grown under cold condition for 3days
Clones 25 Clones [Download: CSV  ,  FASTA ]
whv3n4h06    whv3n7m24    whv3n10n21    whv3n14d18    whv3n15d02    whv3n15d13    whv3n15d14    whv3n15k12    whv3n15k24    whv3n19g18    whv3n19o12    rwhv3n4h06    rwhv3n7m24    rwhv3n8a18    rwhv3n8o19    rwhv3n10n21    rwhv3n14d18    rwhv3n15d02    rwhv3n15d13    rwhv3n15d14    rwhv3n15g08    rwhv3n15k12    rwhv3n15k23    rwhv3n15k24    rwhv3n19g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.86962e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1675
TTTTTTTTTTCTTGAAAGACCATCCTACTCTTTATTATGAAAAGGTATAGACAGATCTCGTCCATTGATGTATTCGGGGGTTGTGCCGAAGAAGAAGATA
TAGACCTATGAGGAATTACGTATGCATGCTCAAGAACCTATGTTCGTACATACATACACAAAATCATATAGAACAAAAGGTATGCTCCGGTCAGAAAGCA
GAGTCGTACAGCAGAGTTTTGGACAAAAGTGAAGTTCACAAAAGACCTTCATACGAGATAGGCCATTGTTTCAACTCGTAGTTTAGGCCTTGCCGGACTC
CTCGCAACCCGGTGGCCTAAAGGCGATGAAGCTGACGCACTGCACCTGGCGCAGGTTGTCGAAGCCGATGACACGGACATAGGCGTCAGGGTACTCCTTC
TTGACCTCCTCCACCTCGTTCAGCACCTGTGTGGCGTCAGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGGCCGTCGTAGTACCCGGGGG
AGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGGGCACCCACTTTGAGCGGATCAGGTAGTCGACCTGTTTCAGGAGGGCCTC
CGTGGATAGGGGTGGCAGGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCGCCATTGCTGACGCTG
CTGAGGCTGCCGCTGGAGCGGCGGCCGACGGGGAGACCGGCTGTGGACTTGAGCCCCTGGAAGGGTGCGACGGTGGTAGCCGAGGAAGCCATCACGGCGG
GGGCCATGGTAATGTATTATCTGGAGGAGAGGAGGATGCCGC
page-top