Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1668
Contig Information
Length 735 bp
Tissue Shoot grown under cold condition for 3days
Clones 23 Clones [Download: CSV  ,  FASTA ]
whv3n6k16    whv3n7g11    whv3n10h10    whv3n11g09    whv3n12l20    whv3n14c04    whv3n15e21    whv3n16a21    whv3n16j13    whv3n19c01    whv3n20c14    rwhv3n1g07    rwhv3n6k16    rwhv3n7g11    rwhv3n10h10    rwhv3n11g09    rwhv3n12l20    rwhv3n14c04    rwhv3n14f24    rwhv3n15e21    rwhv3n16a21    rwhv3n16j13    rwhv3n19c01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipid transfer protein precursor [Triticum aestivum] >gi|54111986|gb|AAV28706.1| lipid transfer protein [Triticum aestivum] >gi|84617225|emb|CAH69208.1| type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 466
Evalue 7.78253e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1668
TTTTTTTTTTAACCGAATAGAGGTAGATTAATTTATAATCCATATATGATAAGCGTACATCGTACAAAGTACAACAAACTCCCGTGTCTGCTCAAAGGGA
GTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCAGCTATGCAAAGCTGGCTCGATGTACGTACTCCTATCTCTCACATGGAGATCA
TATCAGAGCATTTATTCATGTATATGTATATATGTGTGTGTGAGACCTCAACGTACTCAGCATCAATCGCTGGAACTATAATCGGCGATGATGGCGGCCA
GAAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATCGTGTAGGGGACGCTGACGCCGCACTTGGAGGGAATGCCTGCGGCCTTGTTGGGGT
TGAGCCCTCCGGCAACACTCTTGAGGCACCTGCATGTAGCTTGCTTGTCGGCGGTGCTCCGCGCTAAGCCGGCCAATTTCCTGACGCCGCTGCAGCAGGC
CCCAGACGGGCTGGTCCCGCTGCCCTTCGCATAGGCGACGCAGGGGGTCAAGGCAGAGCTCACCTGGCCGCAGCTGATGGCCGCGTCGGAGGCTGCGAGG
ATCATTGCCGCCACCAGGGCGACCAGCACGAGTTTAGTAGCTGCAGTGCGAGCCATCTCGACCGAGTTAGCTGTAGTTGTGGACCTTGTGGTGGTGGGCT
AGCTCACGGAGAGAGGGTGGGATAGCTAGATTGCC
page-top