Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1660
Contig Information
Length 1053 bp
Tissue Shoot grown under cold condition for 3days
Clones 21 Clones [Download: CSV  ,  FASTA ]
whv3n1a04    whv3n5o24    whv3n7j17    whv3n7o12    whv3n7p07    whv3n8e12    whv3n12h08    whv3n14m18    whv3n15b02    whv3n16b06    rwhv3n1a04    rwhv3n5o24    rwhv3n7j17    rwhv3n7o12    rwhv3n7p07    rwhv3n8e12    rwhv3n10c22    rwhv3n12h08    rwhv3n14m18    rwhv3n15b02    rwhv3n16b06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 779
Evalue 1.78449e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1660
TATTAAACTTATATATGATGTCTTTTGATCACAGGACGATCAAATTATGCATCACACGGGTAGTACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGGG
TTCTATTGCTTATGGCGAATTCACATCGGGCCATCCCGGCATCCAGCTACTGGAAAACAACGAGTACGCACTCCATGGCATTGGATTCACATCGGTCGGT
CGGACGATATCTTGATATATGTACGCGTTTGCATTCGCATGTATATATAGGAGTTAACCGCTGGGGAAGATTCACTGCTCCCATGTCTCGAACTTGCCGG
AGACGAAGTCGTAGTGACCGCCGACCAGCTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAACGGGTAGGTCAGGAGGTTCTGGAGGGACACGTTCAC
TGCCTCCTTTTCGAGGACGGTGCACTGGTCATCGAAAGGCATGGAGGCGCACTCAGTCTGCACCTTCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCC
TCGACGAAGTGGAAGGAGTCGTCTGCGCCATCCTTGAGTGAGAGCAGAGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCT
TGAGAGCACAGACGGCGTATTCGATGGCCGATCCAACACCGGCGTACTTGTTCTTGCAGTAGGAGGGGACCATGTTGGCGATGTTGCGGATGGTGAAGGC
CTCGCCGGGCTCCAGGCCCCAGGGTGACCGAGGGGCACACACGGGAGTCGGCGCACGCGAACACCATGTACTTGGGGCGCCTGGCCGGCCTTGAGGGGCT
CGAAGAAATCGGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTCCACGGCGGCGTCCATCAATGCGGGTGCGACGGG
GGCGGCCTGGACGGGGGTGTTCCTGATGAGCTTGGGGCGGAAGGAGGAGGAGTTGGAGGGCGCGGGGGTGCCGAGGCTGGCGACGATGGTGGAGGAGCGG
GCACGGGGCGCGACTACGGTTGCGTAGCACCAGTTAGCCGCGGCGGTCGACAT
page-top