Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1655
Contig Information
Length 781 bp
Tissue Shoot grown under cold condition for 3days
Clones 19 Clones [Download: CSV  ,  FASTA ]
whv3n1d07    whv3n5d03    whv3n6p15    whv3n9d23    whv3n9o23    whv3n10e01    whv3n13h13    whv3n14f21    whv3n19l20    rwhv3n1d07    rwhv3n5d03    rwhv3n6p15    rwhv3n8a07    rwhv3n9d23    rwhv3n9o23    rwhv3n10e01    rwhv3n13h13    rwhv3n14f21    rwhv3n19l20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 783
Evalue 1.53095e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1655
ATATTAGAGTAGTTATATATGATGATTTGTTGGTGGATGATAATGTCTCTTTTTACCAACACACTATAACTTACAAACTCTTTCCCATATCTCTGATGTC
ACGGTCACTGAAATGGTATAACAAAGTGCTGGCCGCCATGTACACCGACACAAGAAAATTGGAACCGATGAACTGAACGCATGGTGAAGCTGGTTTAATT
ATTGTAGACAAGAGTATTCGATATGGTTGCAGCAAAAGGATTGATAAGCGAACAAGGGAGCACTAGTGGGCGTCCTCCTCCTCGCAGTGCTTGGTGTACT
TGGCCGAGTCCAGCAGGCCCTCCAGCTCCGCCGGGCTGCTCGGCTTCACCTTGATCATCCACCCCTCCTCGTACGGGCTCGAGTTGATCAGGCCCGGGGT
CTCGGACAGCTTCGAATTGACCTCGACGACCTCGCCGGAGATGGGCGAGTTGACGTCGCTGGTGGCCTTCACACTCTCCACGTTGCCGAAGGCCCCACCC
TGGCTCACCTTCGTGCCGGTCTCCGGCAGCTCCACGAACACCACCTCCCCGAGATGGCCCTGGGCGTGGTCACTGATGCCAATCGTGGCCACGGAGCCGT
CGTTCTTGACCCACTCGTGGGAGGAAGTGTACTTCAAGCCATCAATAACGGTGGAGAAGTATCTGGAGATCGAGTAGGCCGGGGCAGCGGCCCTGGCGCC
GCTGCTTGAAATCTTGAGGGCATTGGCAGCTGAGCTTGCCCACAGCCTCAGAGCCATTGTAGCCTAATTTAGCTGTTGCCG
page-top