Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1653
Contig Information
Length 599 bp
Tissue Shoot grown under cold condition for 3days
Clones 19 Clones [Download: CSV  ,  FASTA ]
whv3n1a15    whv3n4b20    whv3n7g02    whv3n8i23    whv3n10f09    whv3n10j07    whv3n11e14    whv3n14n23    whv3n20k23    rwhv3n1a15    rwhv3n4b20    rwhv3n8c08    rwhv3n8i23    rwhv3n10f09    rwhv3n10j07    rwhv3n11e14    rwhv3n14n23    rwhv3n20a17    rwhv3n20k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hblt14.2 protein [Hordeum vulgare subsp. vulgare]
Score 238
Evalue 1.35981e-18
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1653
TTTTTTTTTTGATAGGATATGTTTAATTGTTTATTCAAGAAGACGATCGCACTAACAAAGTATTATGTAGTATTACGTTGATGATACGTACATGTGGCAC
ACCAAGGAACGAAAAATACAAACATGAACTGAGAGGAAATACAGATACAGACACTCATTTAGGAACGTGGACATGAGCGAGACGCCGGTGCTTTTCTTCA
GGGCGATGCCAGCTATATAGAAGTCTAAAACCCACAAGTTCAGCTTCAGCTCGTATGTATGTAAGTCAGCTCATGAACTAGAGATGATCATGGTTCATGG
ATGGACAGGGACCCCAGGAACCACCACCAGCGGGCCGTTAATGGTACTGGTTCCGGTACCGGTTCCCACCACCGGCAGGTCTGGCAACCCCGAACCCGAA
GAAGCCTTGGACTCGGCGACGCCGGCACCGCGTGTCGCTCCCAGTGCGCCGTCCTTCTGGCTCAGCTCCCTCCCGTCACAGGACGCGAGCACCACCACCA
ACAGCAGCGCGACGGCGAGACACTTCGCCATTGCTAACTGGGAGGTTCTGAACTTCTGATACTACTGAGGAGACAGTCTTGCTTTAGCTTGTGTGGCTG
page-top