Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1650
Contig Information
Length 1040 bp
Tissue Shoot grown under cold condition for 3days
Clones 18 Clones [Download: CSV  ,  FASTA ]
whv3n1f13    whv3n6h23    whv3n6i04    whv3n7a07    whv3n10e02    whv3n10m06    whv3n11h15    whv3n12n10    whv3n19l07    rwhv3n1f13    rwhv3n2e01    rwhv3n6h23    rwhv3n6i04    rwhv3n10e02    rwhv3n10m06    rwhv3n11h15    rwhv3n12n10    rwhv3n19l07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|15408693|dbj|BAB64099.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|20160872|dbj|BAB89811.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|113534460|dbj|BAF06843.1| Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|125528521|gb|EAY76635.1| hypothetical protein OsI_04589 [Oryza sativa Indica Group] >gi|125572786|gb|EAZ14301.1| hypothetical protein OsJ_004126 [Oryza sativa (japonica cultivar-group)] >gi|215701291|dbj|BAG92715.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737433|dbj|BAG96563.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215764949|dbj|BAG86646.1| unnamed protein product [Oryza sativa Japonica Group]
Score 801
Evalue 2.01599e-83
Total Hit Count 223
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1650
CCCCACAGCCACAGCCACAGACGCGCGAAGCGATATCATCACGAGTTGAGCGTCTAGGCGGGCATCCATGGCACAGTCGATGCTCATGTCCGGCGTCAAC
GGCGTGGCCTCCGGCAGGAGCCTGCTGCAGGCGGCCCGGCCGTCGTCGGCGTCCACGCCCTTCTCGCGGCTCGCGCTCTCCTCCTCCTCGTCGGCGGCAG
CGTACTACAAGCACATGCCGTCCCTCTCCGTCCGGACCATGGCCCTGTTCGGCAAGAAGACCAAGGCCGCGCCGGCCAAGAAGGTCGTTGCCCCCAAGCC
CAAGACCGAGGACGGTATCTTCGGCACGTCCGGCGGGATCGGTTTCACCAAGGAGAACGAGCTCTTCGTCGGCCGTGTTGCCATGATTGGCTTCGCCGCA
TCGATCTTGGGAGAGGCCATCACCGGCAAGGGCATCCTGTCCCAGCTGAACCTTGAGACCGGCATCCCGATCTACGAGGCGGAGCCCCTCCTCCTCTTCT
TCATCCTCTTTACCCTCCTCGGTGCCATCGGCGCGCTCGGAGACCGCGGCAGGTTCGTCGACGAGCAGCCCACCACCGGCCTCGACAAGGCCGTCATCGC
CCCCGGCAAAGGCTTCCGCTCCGCCCTCGGTCTCAGCGAGGGAGGGCCGCTGTTCGGGTTCACCAAGTCGAACGAGCTGTTCGTGGGGCGGCTGGCGCAG
CTGGGGATCGCCTTCTCCATCATCGGGGAGATCATCACGGGCAAGGGCGCGCTGGCGCAGCTCAACATCGAGACCGGGGTGCCCATCAGCGAGATCGAGC
CGCTCGTGCTCTTCAACGTCGTCTTCTTCTTCATCGCCGCCATCAACCCCGGCACCGGCAAGTTCATCAGCGGCGAGGAGGACGACTAGATCACGCGCGA
ATGCTTTTTGGCCATTAATTGTACGTCCGTCCGTCCGTGCTTTGCTTGTTTGTTGTGTACGTGAGACCTTGGGGTGTACTTAGGTGTAAGAAGTTGGTCG
TTGCCTTATGAAAAACAAGAGCTAGCAGGCTAATTTGCCA
page-top