Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1658
Contig Information
Length 789 bp
Tissue Shoot grown under cold condition for 3days
Clones 20 Clones [Download: CSV  ,  FASTA ]
whv3n1d18    whv3n4m09    whv3n5g13    whv3n9m12    whv3n10d02    whv3n10i06    whv3n13j12    whv3n14e24    whv3n19b03    whv3n20k15    rwhv3n1d18    rwhv3n4m09    rwhv3n5g13    rwhv3n5i03    rwhv3n9m12    rwhv3n10i06    rwhv3n14e24    rwhv3n15h23    rwhv3n19b03    rwhv3n20k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 830
Evalue 5.51737e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1658
CCTTCTCTCCTCCAACACCATGGCCCCCACTGTGATGGCTTCCTCGGCCACCTCCGTCGCACCCTTCCAGGGTCTCAAGTCGACCGCCGGCCTGCCCATC
AGCCGCCGCTCCAGCAGCGCCGGCCTCAGCAGCGTCAGCAACGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGGGCATCAAGAAGTTCGAGA
CCCTGTCTTACCTGCCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACTTGATCCGCTCCAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGT
TGGTTTCGTCTTCCGTGAGCACAATAGCTCCCCCGGATACTATGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACA
CAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATCGGCTTCGACAACCTGCGCCAGGTGCAGTGCGTCAGCT
TCATCGCCTTCAGGCCACCGGGTTGCGAGGAGTCTGGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATGTATGAAGGTCTTTTGTGAACGTCACTT
TTGTCCACGACTCTGCTGGACGACCAGAGCATATTTTTCATTCTATATGGTCTGTGTATGTATGTACGAACATAGGTTCTCGAGCATGCATATGCAAATT
CTAGAACCGGCTACACATATACAAAACCTGTGTGATATTTATTATATACAACACGCGGACCATTGTCTTGCTGTTATTAAAAAAAAAAA
page-top