Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1657
Contig Information
Length 774 bp
Tissue Shoot grown under cold condition for 3days
Clones 20 Clones [Download: CSV  ,  FASTA ]
whv3n4i04    whv3n4o03    whv3n4o04    whv3n5e04    whv3n5m18    whv3n10d24    whv3n17h19    whv3n19l18    whv3n20a17    whv3n20o12    rwhv3n1f03    rwhv3n4i04    rwhv3n4o03    rwhv3n4o04    rwhv3n5m18    rwhv3n10d24    rwhv3n18h19    rwhv3n19l18    rwhv3n20g01    rwhv3n20o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold-responsive LEA/RAB-related COR protein [Triticum aestivum]
Score 568
Evalue 1.28468e-56
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1657
CGCCTCGCTGCCGAAGAACACCACAAATTAGTACGTACCAACACTCCATCAACTTCAAAAATGTCTGGTTGGTTTCAAGAGAAGTCCGGCGACGCCACCA
AGACGGCGTCCGAGACGGGGCAGACCATTCAAGACCGCGCCGTCGAGGCAAAAGACCAGACCGGGGCCTTCCTTGGTGAGAAAAGCGAGGCTGTCACGAA
GGCTGCCTCCGAGACTACCGAGGCGGCTAAAAAGATGGGCGGCGAGGCCATGGGGAAGGCGTCCGAGACGGTGGAAGCCGGTAAGGATCACGCCGTCGAG
GGCAAAGACCAGACAGGCAGCTTTTTCGGCGACAAGACTGACGCTGTCAAGAAGACGGCCACCGAGACTGCCGATGCCACCAAGGAGAAGTCCACCGAGG
CCGCCCAGCATGTCCAGGACACCGCTGCACAGTACACCAAGGATACCCCGGTCGCCCCCAAGGAAAACGTCTTCCAGCAGGCCGGCGGGAATATGGTGGG
TGCCGCTACAGACGCCAAGGACGCTGTCATGAACACGCTCGGGATGGGAGGAGACAAGTGAGATGCGGGTGGTGCCACCAAGAAGACCACAAAGGATAAT
AGGCGCGTCTGCGCTTGCTTGCCCTAGCCCTCCTTCTGTTTCGCTATTCCTTCAATATAATTTAATTTCCAGTTCCATGGCACTAATTTACACATGCTCC
TTGGTGTAACCTTTGTATGATGTATCCGACCGAGGTATGAATATATTTTCCACCAATCATAATCAAAAAAAAAA
page-top