Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1613
Contig Information
Length 909 bp
Tissue Shoot grown under cold condition for 3days
Clones 12 Clones [Download: CSV  ,  FASTA ]
whv3n1a20    whv3n3l14    whv3n12o02    whv3n15n23    whv3n19g23    whv3n20c21    rwhv3n1a20    rwhv3n3l14    rwhv3n12o02    rwhv3n15n23    rwhv3n19g23    rwhv3n20c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cytochrome b6-f complex iron-sulfur subunit, chloroplastic; AltName: Full=Rieske iron-sulfur protein; Short=RISP; Short=ISP; AltName: Full=Plastohydroquinone:plastocyanin oxidoreductase iron-sulfur protein; Flags: Precursor >gi|32394644|gb|AAM88439.1| putative Rieske Fe-S precursor protein [Triticum aestivum]
Score 1071
Evalue 8.00644e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1613
GGCAGTGCTAGCTCGCTCGATCGATCGTCCTCTCAACCACCATGGCCTCCACCGCGCTCTCCACCGCCTCCAACCCCACCCAGCTCTGCCGGACCCGCGC
GAGCGCGCTGTGCAAGCCCGTCAAGGGCCTGGGCTTCGGCCGGGAGCGCGTCCCGAGGAACATCACCTGCATGGCCGGCAGCATCTCCGCGGACCGCGTG
CCGGACATGAGCAAGAGGGAGCTGATGAACCTGCTCCTGCTGGGCGCCATCTCGCTCCCCACCTTCGGCATGCTCGTCCCCTACGGCTCCTTCCTCGTCC
CGGCCGGCTCCGGGAGCAACGCCGGAGGCGTCGCCGCCAAGGACAAGCTCGGCAACGACATCCTCGTCGAGGACTGGCTCAAGACGCACGGCCCCAACGA
CCGCACGCTCGCCCAGGGGCTCAAGGGTGATCCTACCTACCTTGTGGTTGAGTCCGACAAGACCCTCGCCACCTACGGGATCAACGCCGTGTGCACGCAT
CTTGGATGCGTCGTGCCGTGGAACGCCGCCGAGAACAAGTTCCTCTGCCCCTGCCATGGATCCCAGTACAACAACCAGGGCAAGGTCGTCCGTGGGCCTG
CACCTCTGTCGCTGGCCCTGGTTCACGCGGACGTTGACGACGGCAAGGTCGTCTTCGTGCCGTGGGTGGAGACCGACTTCAGGACCGGCGACAACCCGTG
GTGGAAATAAGCGACGCAAGCTCCGGCAGCAATGCTCACTTGTGTGATATGTTAAGCCTCCTGCCAGTCCTAAGAACGCTGCTATAAGACTACTCCTGCT
ATAAATGCACCTGTTTCTTGTATCCAGTTATATGTATACAGTCTATGGAAGGAGAAACCTTTTTCATTGCATATATAGTAGTATCACATTTTGAGGGCTA
AAAAAAAAA
page-top