Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1595
Contig Information
Length 782 bp
Tissue Shoot grown under cold condition for 3days
Clones 10 Clones [Download: CSV  ,  FASTA ]
whv3n1e11    whv3n1h11    whv3n10a23    whv3n10a24    whv3n11m22    rwhv3n1e11    rwhv3n1h11    rwhv3n10a23    rwhv3n10a24    rwhv3n11m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Oxygen-evolving enhancer protein 2, chloroplastic; Short=OEE2; AltName: Full=23 kDa subunit of oxygen evolving system of photosystem II; AltName: Full=OEC 23 kDa subunit; AltName: Full=23 kDa thylakoid membrane protein; Flags: Precursor >gi|21837|emb|CAA40669.1| 23kDa oxygen evolving protein of photosystem II [Triticum aestivum]
Score 810
Evalue 1.13274e-84
Total Hit Count 148
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1595
CCTCGTGCCGGTTCAAACTGATGATCCCGGCCAAGTGGAACCCCAGCAAGGAGCGTGAGTTCCCTGGGCAGGTGCTCCGCTACGAGGACAACTTCGACGC
CACCAGCAACCTCTCCGTTATAATCAACCCGACCACCAAGAAGACCATCACCGACTACGGTTCCCCTGAGGAGTTCCTCTCCCAGGTCGGCTTCCTCCTC
GGCCAGCAGTCCTACGGTGGCAAGACCGACTCCGAGGGTGGGTTCGAGTCAGACGCTGTGGCGACGGCGAACGTGCTGGAGAGCTCGGCGCCGGTGGTGG
ACGGTAAGCAGTACTACAGCATAACGGTGCTCACGAGGACCGCGGACGGAGACGAGGGAGGGAAGCACCAGCTCATCACCGCCACCGTCGCCGACGGCAA
GCTCTACGTCTGCAAGGCGCAAGCCGGAGACAAGAGGTGGTTCAAGGGCGCCAAGAAGTTCGTCGAGAACGCCGCAGGATCCTTCAGCGTCGCATAAATA
TACACGACCGACCGGCGAATTTAATGGAAATTTCCTCAGGGATGAACCGTGTAGAGACCGATCGAGGGCATGCATGTGTGTTTCTTTGATTTGTACATGA
GGATGGATGAACTAAGAGGTCGATTTCCCTCAAGGATTCATGTGTGCACAATGATTAAGAAATCTTAGTAATAATGTTTCATTTTTGTATCTCCTTATCT
TTGTTGGCAGCGCTTCAATTTAGTATTGTGAAGAATGTGTTATCAATGTGTCTATATAAGTTTGGTTTTGCTAAAAAAAAAA
page-top