Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1581
Contig Information
Length 672 bp
Tissue Shoot grown under cold condition for 3days
Clones 9 Clones [Download: CSV  ,  FASTA ]
whv3n1c23    whv3n13f06    whv3n16e10    rwhv3n1c23    rwhv3n1l19    rwhv3n13f06    rwhv3n16e10    rwhv3n16m21    rwhv3n17i20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 739
Evalue 1.42036e-76
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1581
TTTTTTTTTTGTCAACAAATAATTTTGTGAACATTCATGGGGGATCAATATCATGAGTAGGCGAGGAAGAAACAATAACAGAAGCTAAAATATAAACCGA
CACCCTGGGTTTAGATTACTAGATACACACACAAACACACATTGTTGCCTCGATTGTTTCCTCTCCACCGATCAACCCACGTACGCATGCACACAAGATG
AGTATCTTCACTTCTGCTCTGCTCTAGTTAGACTCGAGCTGCGCGTACCACACACCCTGGATCTTGACATCCTTGGGCGCCTTGGCGCCGAGGTCGGTGT
CTGACGGCTGCACGCTCTCGAAGACGCCGATCACCTCGCCGGTCTCCGGCTTGCTCTTGGTGACGCTGAGCGTGATGTTGCCCGTGGAGGAGGACGCGTT
CTTCACGTTCTCCTTGGCCAACTCCTCCTCGTCTCCTCTGCCTCCGGCGGGTAGCGCCACGGCGTTGTCGTAGCCAGTAGAGCCACCACGGCCCTTTGGG
TCGAGGAAAGACGAACCCCTGTAGCTGGGCACAAGGAAGGGCCCGCTGAAGCTCTCGGGCTTGCCGGTGGCGACNAGCTGCTTGACGGTGAAGAGGAAGG
GCACGCGCTCGCCTCCGGGGAGCTGCACGGTGACGGCCGCGTANACTATGCCGTCCTTNTCCTCAAACTTGA
page-top