Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1566
Contig Information
Length 1173 bp
Tissue Shoot grown under cold condition for 3days
Clones 9 Clones [Download: CSV  ,  FASTA ]
whv3n7p14    whv3n14o10    whv3n15j20    rwhv3n5a08    rwhv3n7p14    rwhv3n8k14    rwhv3n8o01    rwhv3n14o10    rwhv3n15j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold acclimation protein WCOR410c [Triticum aestivum]
Score 536
Evalue 1.29361e-52
Total Hit Count 147
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1566
TGTACGCTATATATCTTCACAAAATGCAACAATATGTACTGGGCGGAAATCTTTAATATCAAGGCATAATGCCCAGCAAATAACCAATACACAAGCGCCC
ATAATAAGTAAACAAACTTAACAACATCCAGGACCTGACTCTGAACCAAACTGAAACACAAGCATCCGTCACTGAACGGGCTTCACGGACCGAACCTTCA
AAGACGATCAACCCCTCCCACCTTGACACCAACTTAACGTAAAGCAAACACAACACACGCCAACAATTCAATCGAGGTCCGGTCACGAGTCTCGGGCACG
GCGGCGATCAAGCGCTGGGCTTGTGCTCGCCTGCAGCGGCGGCGGCCTTGTCCTCCTCCCCTGTCTTGTGGTAACCAGGCAGCTTGTCCATGATCTTGCC
CAGTAGGCCCTTCTTCTCCTTCGCGTCAGGGCTGCTCACCTCCTCGGCGGCTGGCGCCGGCGCGTGCACTGGTGCTGGAGCAGCGTGCGTGACGGGCACC
GGAGCAGCGTCCTCCGGTTTCTTGTGGCCGCCGGGCAGCTTCTCCTTGATCTTTTCCAAGAAGCCTTTCTTCTCCTCCTCGGGCACTGCCGGTGCCGCCT
CTGTCTTCACGTCACCGTCGATCTTTTCGACGACGACGTCGGTGTCATGGTGGGTCTGCACAGACGCGGGGGCCGCCGGTGCGGGTAGGCCCGTCACGTG
CTCACCCTCGGTGTCCTTGTGGCCGGGCAGCTTCTCCTTGAGCTTCTCCTTGAGACCCTTCTTCTTCTTCCTCTTGATCACCTCACCGTTGTCATCGATC
ACCTCCTCCTCTTCCTCGTCACTAGACGAGCTGGAGCTGGAGCTGGATCGGTGCAGCTTGGAGAAGAGGGTCTCCTTCTTCTCGCCATCCTCGTGCTCCT
CCTTCTTAACCTCGGGCTCTTCCACGGAGACCTTCTCCATGCCGGTGACCAGCTCCTCCTGCTTCTCCTTGTCCTCCTCCGCCTTCTTCTTGCCGAGGAG
GTTGCCGAGGAGGCCCCTGTCTGTCACCTCCACCTGCTCGGCGGCCTCACCTCCCTGGTATGACTGGGTGCTCCTCTCATCCTCCATGATCGAGATCGAT
CGGTGCAGCTAAAAGGTCTTCCGGGAGCTAAAGAAAACAACAGATCAAGTATTGGTTCTTGGCTTGTGGCTTT
page-top