Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1556
Contig Information
Length 1152 bp
Tissue Shoot grown under cold condition for 3days
Clones 8 Clones [Download: CSV  ,  FASTA ]
whv3n2n14    whv3n15p05    rwhv3n1a11    rwhv3n2n14    rwhv3n11d09    rwhv3n15p05    rwhv3n15p10    rwhv3n17f20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 1527
Evalue 1.54299e-167
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1556
TACGTACAACTCAGACTTAGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAAACCGCCTCAAAAACCACCAAATCAAGGGATGAGCACATGG
CGCCGAGAAACAAACTAGCCTAGCCAACAAGTGGATACGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGTGACATCCTCCTTGCAATTAAAAG
GGGGGCTCTGCTATACGAGCACGGCTTACTGCGCCTTGGCGAGCTCGGCACGGATCTGCTTGGCGGCCTCAACCATGTTGGTGAGGGCAGGCTTGACCTC
GGCGTACTTGCGGGTCTTGAGACCGCAGTCAGGGTTCACCCACAGGATGTTGGTGTCCAGGACCGCGAGCATCTTGTTGACACGGTCGGCAATCTCCTCC
TTGGACGGGATCCTGGGGGAGTGGATGTCGTACACACCCGGGCCAATGCCAGCACCGTACACCACACCCTCGCGGAAGACGGACAGAAGCTTCTCGTCGG
ACCGCGAGTTCTCGATGGTGATCACATCAGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGT
GGTGTCCTGCACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCATGCTCAGACTTGCGGAGTGGCAGACCCTCTCTCAAA
GCAGCCTCGTCAATTTGGATGACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCTTGATTGCAAGAGCAATCTGGTAGCAAGTCTCAAACCTCG
GTTGGTCATTTCTAACAAAAGACCAGTTAAGGATTGTGACAGGGCCTGTCAACATTCCCTTCATTGGGCGAGCAGTCATGCTCTGTGCCATCTTGGACCA
GAACACAGTCATGGGGTTGGGGCGGCTCACATCACCGTAGATAATCGGTGGCTTGACACACCTTGATCCATAAGATTGCACCCAGCCATTGGCAGTGAAT
GTGAAACCAGAGAGCTGCTCACCGAAGTACTCAACCATATCGTTCCTCTCTGGCTCTCCGTGCACAAGCACATCAATGTCAAGCTCTTCTTGGATCTTAA
CAACCTTGATAATTTCCTCCTTGATGGCATTGGTGTACTCCTCCTCAGAGAT
page-top