Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1518
Contig Information
Length 645 bp
Tissue Shoot grown under cold condition for 3days
Clones 7 Clones [Download: CSV  ,  FASTA ]
whv3n1d19    whv3n1l21    whv3n12k24    rwhv3n1d19    rwhv3n1l21    rwhv3n5m20    rwhv3n12k24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 6, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390383|pdb|2J37|6 Chain 6, Model Of Mammalian Srp Bound To 80s Rncs
Score 544
Evalue 5.39483e-54
Total Hit Count 425
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1518
TTTTTTTTTTAAGTCAAAACTTCAAGCACTTGAACAAAATATCCAACGTCTCAAATCTTCTATCAAGAAGTCATGGAACATCATGAACAGTAGATAACAA
TAAGCTAAAGCAAGACTTCCCAATATGCTCTCAGCAGATATGTATTAAATTCTAACTGATTGAAACAACAGACAGGGGGTTTAGTCCTCATCCTCCACAA
CCTTGGTACCCAAACCTTTAAGACCTTCCTGGGGGACTTCAGCAACTGTGACCAGAGAGTACAGCTCCTCCTTAGCGTCCTCCTCGTCGTTCCTCTTGCG
GGCAATCCTGACACGGACTCTCCTCGGGACACTCCTGATGCCGCTGCTCCAGATGTGCTTGTTGAGCTTCACGTCAATGCGGACATCGTTGGTTCCCATG
GCCTTCTGTGCAAACTTCCTGATCTCCTTGATGGCATTTGGTGCCTTCTTCTTGAAGGTGCATCCATGGAGGCGCTTGTGGAGGTTGACAGTGTACTCGC
GGGTCACCACCTCGTCCTTGCGCGGGCCGGGGGCGCGCTTCTTCTCCGACATCGCCGACGGCCTCCTTTCGCCCTGCTCCTCTCTTGGCTTCGATGGAGG
CTGCGGCGAGAGGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
page-top