Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1487
Contig Information
Length 1202 bp
Tissue Shoot grown under cold condition for 3days
Clones 6 Clones [Download: CSV  ,  FASTA ]
whv3n1b11    whv3n18c01    rwhv3n1b11    rwhv3n12f23    rwhv3n17c01    rwhv3n17m20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37876 [Oryza sativa Indica Group]
Score 1144
Evalue 4.23653e-123
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1487
GTTTACAATACAAAAAACTGTAGAGAGGATAAGAGCAAATGCACCCTGTCTGAAGCACCTGGATTGCACGCAAGAAGCGGTTTCCAAGAACATCACTGGT
GCATACTTCCTCCGTCCCTTAATATAAGGACGTTTTTTATACTACACTTATATTATCACAAAGGGAGTATTTCACAAAAATGAAAAAAAAAACTCGAGCA
GGTTGTCTGAACTGCTCAGGAGCAATGCACTTGAGNGGATCAATCAAGAGCCAAAGCCAGCAATGTTTCCTTTCCCCTTAAATTATATATGCATATTACT
GTATATTTTATACATACAGTTTATACAAATATATACACCTGACCTGACTGCTGCACCTATGAAGAGATATGTGCTGGAAGGAAATGAAAACGCTGTATTG
TATATATGCTTAACAATCTACGAGTATATATCTATACCAACAACTATACAGCGACCGCCGGGGCTGGAAGTTCCGGCAGGCCGCTCTCGCCATTCAGCAC
AATGACTTTCCCCTCCGGGTCCACATCAACGATGACAGAGTCGCCCTCCTTGACCTCCCCCCCCAAAATCTTCTCCGCGAGGCTGTCCTCCAGGAGCCTC
ATGATGGCCCTCCTCAGCGGCCGCGCTCCGTAGCTAGGGTTGTACCCTTCGTCCACGACCCGCTCCTTGAACTTCTCCGTCACCTGCAGGTTGATGTCCT
TGGTCTTGAGCCTGGTGAAAACCTCCTGCAGCATTATGTCCGCGATCTCTTTGACTTCCAGCTTGGTCAGCTGTCTGAAGACGATCATCTCGTCCAGACG
GTTGAGAAACTCTGGTCGGAAGTACTGCTTCATCTCCTCGATCACCAAGCTCTTGATCCTGCCATAGCTGCTGTCCTTCTCGTCCGAGTCGAGGTCGAAC
CCGATCTTCCTCCCCCCCTTCTCAATCACGCTGCTCCCAACATTTGATGTCATTATCAGGAGCGTGTTCTTGAAGTCCACTGTTCTCCCCTTGCTGTCGG
TTAACCTTCCGTCTTCCAGGATCTGGAGCATCATGTTGAACACATCCGGATGTGCCTTCTCAATCTCATCAAAAAGCACAACGCTGTATGGCCGCCGTCG
AACCGCCTCCGTCAGCTGCCCACCTTCAGTGTATCCCACATAGCCTGGTGGTGAACCGATCAACTTGGACACAGTGTGCCTCTCCATGAACTCACTCATA
TC
page-top