Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1469
Contig Information
Length 1242 bp
Tissue Shoot grown under cold condition for 3days
Clones 6 Clones [Download: CSV  ,  FASTA ]
whv3n1b09    whv3n7o03    whv3n18m18    rwhv3n1b09    rwhv3n7o03    rwhv3n17m18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1628
Evalue 3.34932e-179
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1469
CACTCTCCCTATCCCCGTGTCCAGAATCTACCCCCCGGCTCCAATGGCGGCGAAGGAACCGATGCGCGTGCTCGTCACCGGCGCCGCAGGACAAATCGGA
TATGCTCTTGTTCCCATGATTGCCAGGGGAGTTATGCTTGGTGCAGACCAGCCTGTTATTCTGCATATGCTGGATATTGAATTTGCTGCTGAAGCTCTTA
AAGGCGTCAAGATGGAGTTGATCGATGCCGCATTTCCACTTCTCAAGGGAGTTGTTGCAACAACTGATGTTGTTGAGGCTTGCACTGGTGTGAATGTTGC
GGTTATGGTTGGTGGATTCCCCAGGAAGGAAGGAATGGAAAGGAAGGATGTTATGACGAAAAATGTTTCAATCTACAAAGCTCAAGCATCTGCTCTTGAA
GCTCATGCAGCCCCCAACTGCAAGGTTTTGGTTGTTGCCAACCCAGCAAACACCAATGCTCTCATCCTGAAGGAGTTTGCTCCATCTATCCCTGAGAAGA
ACATCAGTTGTTTGACCCGCCTAGACCACAACAGGGCACTCGGTCAGATTTCTGAGAGACTTGGTGTCCAAGTTTCTGACGTGAAGAATGCTATTATCTG
GGGTAATCACTCGTCCAGTCAGTACCCTGATGTTAACCACGCCACTGTGAAGACTTCCAGTGGAGAGAAGCCTGTTCGTGAACTTGTTCAAGATGATGAA
TGGCTAAACGGGGAGTTCATTGCCACTGTCCAGCAGCGTGGTGCTGCAATCATCAAAGCGAGGAAGCTCTCCAGTGCTCTCTCTGCTGCCAGCTCAGCTT
GTGATCACATCCGTGACTGGGTTCTGGGAACCGCCGAGGGAACATTTGTTTCCATGGGTGTGTACTCTGATGGTTCATACGGTGTGCCTGCTGGTCTTAT
CTACTCCTTCCCAGTAACGTGCAGTGGTGGTGAATGGACAATTGTTCAAGGGCTCCCGATCGATGAGTTCTCGAGGAAGAAGATGGATGCCACCGCCCAG
GAGCTGTCGGAGGAGAAGGCGCTGGCCTACTCATGCCTCGCGTAAATCCACATTCGAAGGGCAGCTGCTCCTCTGATGTTTTGAATAAATGAAACCTTCC
GCTCCTTAGAAACTCTCGTCTCCACCCAGAACAGCCGCACATCGCGATGCATGCTCCTTTTCGCTGGTTTTCCCAGTGTGTATGAATGAGGCTTGTAGCT
CCCCTTTTGCCTGATGATTTACAGGACAGTACATTGCGAAGA
page-top