Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1433
Contig Information
Length 912 bp
Tissue Shoot grown under cold condition for 3days
Clones 5 Clones [Download: CSV  ,  FASTA ]
whv3n1d04    whv3n7o04    rwhv3n1d04    rwhv3n6k17    rwhv3n7o04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit seed maturation protein [Zea mays]
Score 1023
Evalue 2.98193e-109
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1433
GTAGTATTAACTAAAGACAGACGCAATGACACAGAACCATCCTTCAAAATGAGGCAACAAGTTGAGATTAACACAGATGGCAATACGCGGCAGGGTAACT
CTTGTGATCTAGTGCTTCTTGTTCTTCGGGATCTTCGACAGGACCTTCTCTTCAAAGATGGCATAATACTTCTTCAATTCGATCATGGCCTTCTCACCAA
AAGCATCCACCTTGTCATCGTACTTCTCATACAGAACTGGCACAGTGTACAGCACCACAAAGACTATATATGACAGTGTCAAAAAGTTGCAGTAGCTCCC
AAGAACAGAAAGAAGCCAGAGCCCTCCAATCACAATGAGGAATTTCTTCAGATCACGACCATGACCAGTCTCTCTCAAGGTAAAGAAGCCCCGGTTGATC
TCATGCCGCAGTGATAGTGCAATGTTTACAGTCATGTCCTCCGGGATTTTCACCTCAGGGATGTTCGGGGGAGACTTGTGGATGAAAATGCAGACATTGG
AATAGAGGAAGAGGGTTGCCAGGGAGAGGATGAGGCAGTGGCCCACCAAGGTGAGCAGATGGTACTCCATGACCTCGAACAGCAGCCAGATGGCAGTAGC
GCCAGCAAGCACCCCTCCGGAGACCTTCTTGTTCCTCCATAGAACAAGATCAGCAGGCTTGCCGCCGCCGAGGACGGCGTGGACGGGCTTCTCGCGGCCG
AAGAGGCGGTAGATCTTGGCCTTGACGCCCGCCGCCGACCCCTTCTTCTCGTCGTCCGAGTCCGAGGACGACGACGACGAGTCCCCACCGTGGAACTTGT
CGGAGATCTTGTCCATCATGGACTCCGCCACCGGCTCCTCCTTGTGCTCCGCCATGCTCCCTAGTCCCCCCACGCTCTCCTCCCGAGCTTTTCTTCTGGT
TGGTTTTCCTTT
page-top