Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1415
Contig Information
Length 831 bp
Tissue Shoot grown under cold condition for 3days
Clones 5 Clones [Download: CSV  ,  FASTA ]
whv3n1f23    whv3n20i17    rwhv3n1f23    rwhv3n17p15    rwhv3n20i17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 5.68003e-69
Total Hit Count 400
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1415
ACCGAAATGTTTAAAGAAACTCTGCATAAGCAACATCCAACAGAACAAACACGATATGATATTTAAGGTATCTCATACGCGGCACACAGATATTGCACAG
AAAACAGTTCTGAACTTCAGATGCTCCAAAATCAGGCTAACCCTTCATGATACCAGAAAGCTAAAGCTTCATGTCAGACCTTCACTTCTTGGCCTTGGCC
TTCTTTGGTGCCGCTGCTGCTGGAGCTGGAGCTGCAGCCGCTGGTGCTGGTGCATGATCTCTGGGGCCCTGAGCCAATCTCTCCTCCCTCCTGGCATGCT
TCCTCTCCCTGCTTGCCTTGCTCTTGGCGCGCTTGGCCTCAAACTGGTCAGAGAGGGTCTTCTCTCTTGCCTTCTCAGCCTTGGACTTGTGGATACTCTC
CATGAGGACCCTCTTGTTCTTGAACATGTTACCCTTGACCTTCAGGTACATGTCATGGTACATGTGCTTGTCGATCTTCTTGGCCTCACGGTACTTGCGC
AGAAGGCGCCTCAGGACGCGCATCCTCCGCATCCACAGGATCTTGGTGGGGAGCCTAGCCTCCCTGGTACCCCTACGCTTACCATATCCAGAGTGACGGC
CCTTCTGCTTGGCCTCATGTGCCCTCCTTGCACGAGACCTGGAGTGGATCTTCTGAGGCTTCCTGATGATGAAACCATCCTTTACCAGCTTCCGGATGTT
CTGCCGGGAGTTGGCCATGGAGATCTCGTTGACCTCATTGGGGTCGAGCCAGACCTTGCCCTTGCCGCACTTGAGGACGCTCGAGGCCAGGCGCTTCTGC
AGCTTCAGCGACACCATCTTCGCCGCCGCTC
page-top