Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1414
Contig Information
Length 1002 bp
Tissue Shoot grown under cold condition for 3days
Clones 5 Clones [Download: CSV  ,  FASTA ]
whv3n1l19    whv3n13b06    whv3n19k18    rwhv3n13b06    rwhv3n19k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 1400
Evalue 6.65265e-153
Total Hit Count 183
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1414
GCAAGTGCGCCGACGCCGCCAAGATGGCCGGCTTCGCCCTCGCCACCTCTGCCCTCCTCGTCTCCGGCGCGAGCGCGGAGGGGGCGCCCAAGAGGCTGAC
CTTCGACGAGATCCAGAGCAAGACCTACATGGAGGTGAAGGGTACCGGCACCGCGAACCAGTGCCCGACCATCGACGGCGGCGTCGACTCCTTCCCCTTC
AAGGCCGGCAAGTACGAGATGAAGAAGTTCTGCCTGGAGCCCACCTCCTTCACCGTCAAGGCCGAGGGCATCCAGAAGAACGAGCCGCCGGCCTTCCAGA
AAACCAAGCTCATGACCCGTCTCACCTACACCCTTGACGAGATGGAAGGCCCGCTCGAGGTCGGCGCCGACGGCACCCTCAAGTTCGAGGAGAAGGACGG
CATCGACTACGCGGCCGTCACCGTGCAGCTCCCCGGAGGCGAGCGAGTGCCCTTCCTCTTCACCGTCAAGCAGCTCGTCGCTACCGGCAAGCCCGAGAGC
TTCAGCGGGCCCTTCCTCGTGCCCAGCTACAGGGGTTCGTCTTTCCTCGACCCAAAGGGCCGTGGTGGCTCTACTGGCTACGACAACGCCGTGGCGCTAC
CCGCCGGAGGCAGAGGAGACGAGGAGGAGTTGGCTAAGGAGAACGTGAAGAACGCGTCCTCGTCCACGGGCAACATCACGCTCAGCGTGACCAAGAGCAA
GCCGGAGACCGGCGAGGTGATCGGTGTCTTCGAGAGCGTGCAGCCGTCAGACACCGACCTCGGCGCCAAGGCGCCCAAGGATGTCAAGATCCAGGGTGTG
TGGTACGCGCAGCTCGAGTCTAACTAGAGCAGAGCAGAAGTGAAGATACTCATCTTGTGTGCATGCGTACGTGGGTTGATCGGTGGAGAGGAAACAATCG
AGGCAACAAATGTGTTTGTGTGTGTATCTAGTAATCTAAACCCAGGGTGTCGGTTTATATTTTAGCTTCTGTTATTATTGTTTCTTCCTCGCCAACTCAT
GA
page-top