Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V483_all.Contig1340
Contig Information
Length 1014 bp
Tissue Shoot grown under cold condition for 3days
Clones 4 Clones [Download: CSV  ,  FASTA ]
whv3n5j20    whv3n11j05    rwhv3n5j20    rwhv3n11j05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 3.87183e-132
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V483_all.Contig1340
GGGCGCGTAGCACAGGAGAAGGAGCAGGCGGCGGTGGTGCCCGAAGACGAGAAGCACGGCGACCTAGCCCGAGCTCGCAACCATGGCTAGGGGTTTGAAG
AAGCATCTGAAGAGGCTCAATGCCCCGTCTCACTGGATGCTTGACAAGCTTGGTGGAGCTTTTGCCCCCAAGCCATCATCTGGTCCTCACAAGGCCAGGG
AGTGCCTTCCTCTGATCCTCATCCTGAGGAACAGACTGAAATATGCTCTCACCTACCGTGAAGTGCAGTCTATCCTTATGCAGCGTCATATCATGGTTGA
TGGAAAGGTCCGCACTGACAAGACCTACCCTGCTGGTTTCATGGACATCATTTCCATTCCCAAGACTGGTGAGAACTACAGGCTTCTGTATGACACCAAG
GGCCGCTTCCGCCTTCACTCTGTCAGGGATGAGGATGCTAAGTTCAAGCTCTGCAAGGTCAGGTCTGTCCAGTTCGGCCAGAAGGGCATCCCCTACCTGA
ACACCTATGATGGCCGCACCATCCGCTACCCAGACCCTCTCATCAAGGCCAATGACACTATCAAGCTCGACCTGGAGACCAACAAGATTGTTGACTTCAT
CAAGTTCGACGTTGGTAACGTGGTCATGGTGACTGGCGGGCGCAACACTGGGCGTGTTGGTGTGATCAAGAACAGGGAGAAGCATAAGGGAACCTTCGAG
ACCATCCACGTTGAGGATGCCCAGGGCCACCAGTTCGCCACCCGTCTGGGCAATGTATTCACCATTGGCAAGGGCACCAAGCCATGGGTGAGCCTCCCCA
AGGGCAAGGGTATCAAGCTCACCATCATTGAGGAGCAGAGGAAGCGGGATGCCGCTGCCCAGGCTGCTGCCAAGGCCTGATTCTGAGGCGTTGAGTCGTT
TTGCTATAGCCAGTTATCTGCAAGGATATAGAACTATGTTCCTGGAACCATCGTTTTTAAGTTTTGCCTGATGTTTGTTGATTTGCGAACTCGTGGTTGC
CTCTAGATGTAATG
page-top